ID: 994941314 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:106327398-106327420 |
| Sequence | ACTCACATAGTGAAGTTTTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 994941314_994941319 | 17 | Left | 994941314 | 5:106327398-106327420 | CCAGAAAACTTCACTATGTGAGT | No data | ||
| Right | 994941319 | 5:106327438-106327460 | CCTCTTGGTATGTGTGTTGTAGG | No data | ||||
| 994941314_994941315 | 2 | Left | 994941314 | 5:106327398-106327420 | CCAGAAAACTTCACTATGTGAGT | No data | ||
| Right | 994941315 | 5:106327423-106327445 | TAAACCTTTTCATACCCTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 994941314 | Original CRISPR | ACTCACATAGTGAAGTTTTC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||