ID: 994941314

View in Genome Browser
Species Human (GRCh38)
Location 5:106327398-106327420
Sequence ACTCACATAGTGAAGTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994941314_994941319 17 Left 994941314 5:106327398-106327420 CCAGAAAACTTCACTATGTGAGT No data
Right 994941319 5:106327438-106327460 CCTCTTGGTATGTGTGTTGTAGG No data
994941314_994941315 2 Left 994941314 5:106327398-106327420 CCAGAAAACTTCACTATGTGAGT No data
Right 994941315 5:106327423-106327445 TAAACCTTTTCATACCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994941314 Original CRISPR ACTCACATAGTGAAGTTTTC TGG (reversed) Intergenic
No off target data available for this crispr