ID: 994947617

View in Genome Browser
Species Human (GRCh38)
Location 5:106416031-106416053
Sequence CAAAGTCCTGTTTGAAGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994947616_994947617 13 Left 994947616 5:106415995-106416017 CCTCGACTTTTAGCTGCAGACAG 0: 1
1: 0
2: 0
3: 8
4: 76
Right 994947617 5:106416031-106416053 CAAAGTCCTGTTTGAAGAGCCGG No data
994947615_994947617 24 Left 994947615 5:106415984-106416006 CCTGGTGAGCTCCTCGACTTTTA 0: 1
1: 0
2: 1
3: 3
4: 69
Right 994947617 5:106416031-106416053 CAAAGTCCTGTTTGAAGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994947617 Original CRISPR CAAAGTCCTGTTTGAAGAGC CGG Intergenic
No off target data available for this crispr