ID: 994957096

View in Genome Browser
Species Human (GRCh38)
Location 5:106546050-106546072
Sequence AAGCTGAGACTGCTGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994957093_994957096 14 Left 994957093 5:106546013-106546035 CCCAGTTGCACAGATGGGTCCTT No data
Right 994957096 5:106546050-106546072 AAGCTGAGACTGCTGCAGAGTGG No data
994957095_994957096 -5 Left 994957095 5:106546032-106546054 CCTTATACAAGCAATACTAAGCT No data
Right 994957096 5:106546050-106546072 AAGCTGAGACTGCTGCAGAGTGG No data
994957094_994957096 13 Left 994957094 5:106546014-106546036 CCAGTTGCACAGATGGGTCCTTA No data
Right 994957096 5:106546050-106546072 AAGCTGAGACTGCTGCAGAGTGG No data
994957091_994957096 19 Left 994957091 5:106546008-106546030 CCTGTCCCAGTTGCACAGATGGG No data
Right 994957096 5:106546050-106546072 AAGCTGAGACTGCTGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994957096 Original CRISPR AAGCTGAGACTGCTGCAGAG TGG Intergenic
No off target data available for this crispr