ID: 994962014

View in Genome Browser
Species Human (GRCh38)
Location 5:106617367-106617389
Sequence GCATCTTCTAAGTTGTGCTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994962014_994962017 29 Left 994962014 5:106617367-106617389 CCGTAGCACAACTTAGAAGATGC No data
Right 994962017 5:106617419-106617441 GATTATTAACTTTTCTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994962014 Original CRISPR GCATCTTCTAAGTTGTGCTA CGG (reversed) Intergenic
No off target data available for this crispr