ID: 994962017

View in Genome Browser
Species Human (GRCh38)
Location 5:106617419-106617441
Sequence GATTATTAACTTTTCTACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994962014_994962017 29 Left 994962014 5:106617367-106617389 CCGTAGCACAACTTAGAAGATGC No data
Right 994962017 5:106617419-106617441 GATTATTAACTTTTCTACACTGG No data
994962016_994962017 7 Left 994962016 5:106617389-106617411 CCTTGGTTACGCTGATAGTTTTA No data
Right 994962017 5:106617419-106617441 GATTATTAACTTTTCTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994962017 Original CRISPR GATTATTAACTTTTCTACAC TGG Intergenic
No off target data available for this crispr