ID: 994965264

View in Genome Browser
Species Human (GRCh38)
Location 5:106661905-106661927
Sequence CAGAGCTTTCATATTTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994965259_994965264 0 Left 994965259 5:106661882-106661904 CCACAAGTTTGTGGTATAGTTTT No data
Right 994965264 5:106661905-106661927 CAGAGCTTTCATATTTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994965264 Original CRISPR CAGAGCTTTCATATTTTGGG GGG Intergenic
No off target data available for this crispr