ID: 994968403

View in Genome Browser
Species Human (GRCh38)
Location 5:106703604-106703626
Sequence TGAAGAAATTAGAGAGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994968403_994968405 -5 Left 994968403 5:106703604-106703626 CCCATATCTCTCTAATTTCTTCA No data
Right 994968405 5:106703622-106703644 CTTCACAGACTACTCTGTCTAGG No data
994968403_994968407 18 Left 994968403 5:106703604-106703626 CCCATATCTCTCTAATTTCTTCA No data
Right 994968407 5:106703645-106703667 AATGATGGCAATTGTCTTCCTGG No data
994968403_994968406 3 Left 994968403 5:106703604-106703626 CCCATATCTCTCTAATTTCTTCA No data
Right 994968406 5:106703630-106703652 ACTACTCTGTCTAGGAATGATGG No data
994968403_994968408 19 Left 994968403 5:106703604-106703626 CCCATATCTCTCTAATTTCTTCA No data
Right 994968408 5:106703646-106703668 ATGATGGCAATTGTCTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994968403 Original CRISPR TGAAGAAATTAGAGAGATAT GGG (reversed) Intergenic
No off target data available for this crispr