ID: 994968405

View in Genome Browser
Species Human (GRCh38)
Location 5:106703622-106703644
Sequence CTTCACAGACTACTCTGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994968404_994968405 -6 Left 994968404 5:106703605-106703627 CCATATCTCTCTAATTTCTTCAC No data
Right 994968405 5:106703622-106703644 CTTCACAGACTACTCTGTCTAGG No data
994968399_994968405 29 Left 994968399 5:106703570-106703592 CCTACTCTTGTTCGTGATGACCT No data
Right 994968405 5:106703622-106703644 CTTCACAGACTACTCTGTCTAGG No data
994968401_994968405 4 Left 994968401 5:106703595-106703617 CCCAACAATCCCATATCTCTCTA No data
Right 994968405 5:106703622-106703644 CTTCACAGACTACTCTGTCTAGG No data
994968400_994968405 9 Left 994968400 5:106703590-106703612 CCTTTCCCAACAATCCCATATCT No data
Right 994968405 5:106703622-106703644 CTTCACAGACTACTCTGTCTAGG No data
994968402_994968405 3 Left 994968402 5:106703596-106703618 CCAACAATCCCATATCTCTCTAA No data
Right 994968405 5:106703622-106703644 CTTCACAGACTACTCTGTCTAGG No data
994968403_994968405 -5 Left 994968403 5:106703604-106703626 CCCATATCTCTCTAATTTCTTCA No data
Right 994968405 5:106703622-106703644 CTTCACAGACTACTCTGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994968405 Original CRISPR CTTCACAGACTACTCTGTCT AGG Intergenic
No off target data available for this crispr