ID: 994968445

View in Genome Browser
Species Human (GRCh38)
Location 5:106703877-106703899
Sequence CAGTGGTTCTGTGGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994968445_994968454 27 Left 994968445 5:106703877-106703899 CCTTCTTCCCCACAGAACCACTG No data
Right 994968454 5:106703927-106703949 CTTTTGGTCTCAGATGCTTTGGG No data
994968445_994968453 26 Left 994968445 5:106703877-106703899 CCTTCTTCCCCACAGAACCACTG No data
Right 994968453 5:106703926-106703948 TCTTTTGGTCTCAGATGCTTTGG No data
994968445_994968451 11 Left 994968445 5:106703877-106703899 CCTTCTTCCCCACAGAACCACTG No data
Right 994968451 5:106703911-106703933 GGCTTCCTAAATGATTCTTTTGG No data
994968445_994968449 -10 Left 994968445 5:106703877-106703899 CCTTCTTCCCCACAGAACCACTG No data
Right 994968449 5:106703890-106703912 AGAACCACTGTGACTTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994968445 Original CRISPR CAGTGGTTCTGTGGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr