ID: 994968643

View in Genome Browser
Species Human (GRCh38)
Location 5:106707235-106707257
Sequence CTATATACATAGATTGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994968643_994968645 16 Left 994968643 5:106707235-106707257 CCTCCTTCAATCTATGTATATAG No data
Right 994968645 5:106707274-106707296 TTCTCACTTCATCATAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994968643 Original CRISPR CTATATACATAGATTGAAGG AGG (reversed) Intergenic
No off target data available for this crispr