ID: 994969688

View in Genome Browser
Species Human (GRCh38)
Location 5:106719566-106719588
Sequence GCGCCGTTTTTTAAGCTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994969684_994969688 8 Left 994969684 5:106719535-106719557 CCGAGCCAGGTGCGGGATATAAT 0: 636
1: 1265
2: 1149
3: 581
4: 360
Right 994969688 5:106719566-106719588 GCGCCGTTTTTTAAGCTGGTCGG No data
994969682_994969688 12 Left 994969682 5:106719531-106719553 CCCTCCGAGCCAGGTGCGGGATA 0: 496
1: 1490
2: 1803
3: 1148
4: 796
Right 994969688 5:106719566-106719588 GCGCCGTTTTTTAAGCTGGTCGG No data
994969685_994969688 3 Left 994969685 5:106719540-106719562 CCAGGTGCGGGATATAATCTCGT 0: 307
1: 1004
2: 2073
3: 1436
4: 947
Right 994969688 5:106719566-106719588 GCGCCGTTTTTTAAGCTGGTCGG No data
994969678_994969688 26 Left 994969678 5:106719517-106719539 CCGTGGGCATAGGACCCTCCGAG 0: 245
1: 1381
2: 1654
3: 1012
4: 697
Right 994969688 5:106719566-106719588 GCGCCGTTTTTTAAGCTGGTCGG No data
994969683_994969688 11 Left 994969683 5:106719532-106719554 CCTCCGAGCCAGGTGCGGGATAT 0: 494
1: 1487
2: 1828
3: 1188
4: 779
Right 994969688 5:106719566-106719588 GCGCCGTTTTTTAAGCTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994969688 Original CRISPR GCGCCGTTTTTTAAGCTGGT CGG Intergenic
No off target data available for this crispr