ID: 994970418

View in Genome Browser
Species Human (GRCh38)
Location 5:106730437-106730459
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994970413_994970418 17 Left 994970413 5:106730397-106730419 CCAGAGGGTTTGGTGCAGGAGCA No data
Right 994970418 5:106730437-106730459 CCAAGGATGTCCATCCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type