ID: 994971960

View in Genome Browser
Species Human (GRCh38)
Location 5:106750925-106750947
Sequence TCAAAAGCCCAGAAATATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994971960_994971963 12 Left 994971960 5:106750925-106750947 CCATGATATTTCTGGGCTTTTGA No data
Right 994971963 5:106750960-106750982 CAAAGAAATAGGAGCAGAACTGG No data
994971960_994971964 13 Left 994971960 5:106750925-106750947 CCATGATATTTCTGGGCTTTTGA No data
Right 994971964 5:106750961-106750983 AAAGAAATAGGAGCAGAACTGGG No data
994971960_994971962 1 Left 994971960 5:106750925-106750947 CCATGATATTTCTGGGCTTTTGA No data
Right 994971962 5:106750949-106750971 TGCTAATGTGGCAAAGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994971960 Original CRISPR TCAAAAGCCCAGAAATATCA TGG (reversed) Intergenic
No off target data available for this crispr