ID: 994974823

View in Genome Browser
Species Human (GRCh38)
Location 5:106788588-106788610
Sequence TATATTCTGAAGGCCAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994974823_994974826 30 Left 994974823 5:106788588-106788610 CCATGCCTGGCCTTCAGAATATA No data
Right 994974826 5:106788641-106788663 CTGTATACTCATAATGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994974823 Original CRISPR TATATTCTGAAGGCCAGGCA TGG (reversed) Intergenic
No off target data available for this crispr