ID: 994974826

View in Genome Browser
Species Human (GRCh38)
Location 5:106788641-106788663
Sequence CTGTATACTCATAATGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994974825_994974826 20 Left 994974825 5:106788598-106788620 CCTTCAGAATATAAAAATTAATG No data
Right 994974826 5:106788641-106788663 CTGTATACTCATAATGAGCATGG No data
994974823_994974826 30 Left 994974823 5:106788588-106788610 CCATGCCTGGCCTTCAGAATATA No data
Right 994974826 5:106788641-106788663 CTGTATACTCATAATGAGCATGG No data
994974824_994974826 25 Left 994974824 5:106788593-106788615 CCTGGCCTTCAGAATATAAAAAT No data
Right 994974826 5:106788641-106788663 CTGTATACTCATAATGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994974826 Original CRISPR CTGTATACTCATAATGAGCA TGG Intergenic
No off target data available for this crispr