ID: 994978867

View in Genome Browser
Species Human (GRCh38)
Location 5:106846445-106846467
Sequence GGAAAAGCCTGGGGTAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994978861_994978867 1 Left 994978861 5:106846421-106846443 CCAACACTGATCTATTTGTATAT No data
Right 994978867 5:106846445-106846467 GGAAAAGCCTGGGGTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994978867 Original CRISPR GGAAAAGCCTGGGGTAAAAG AGG Intergenic
No off target data available for this crispr