ID: 994991702

View in Genome Browser
Species Human (GRCh38)
Location 5:107004798-107004820
Sequence GACACAGTGGTGCCTCACTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994991702_994991706 12 Left 994991702 5:107004798-107004820 CCGGAGTGAGGCACCACTGTGTC No data
Right 994991706 5:107004833-107004855 CGAGAGAAGCCATTGTTCCCAGG No data
994991702_994991708 22 Left 994991702 5:107004798-107004820 CCGGAGTGAGGCACCACTGTGTC No data
Right 994991708 5:107004843-107004865 CATTGTTCCCAGGATTCTGTAGG No data
994991702_994991709 23 Left 994991702 5:107004798-107004820 CCGGAGTGAGGCACCACTGTGTC No data
Right 994991709 5:107004844-107004866 ATTGTTCCCAGGATTCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994991702 Original CRISPR GACACAGTGGTGCCTCACTC CGG (reversed) Intergenic
No off target data available for this crispr