ID: 994994362

View in Genome Browser
Species Human (GRCh38)
Location 5:107041006-107041028
Sequence TTGTGAACAGAGATGAACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994994359_994994362 -8 Left 994994359 5:107040991-107041013 CCCCTAGAACAAATTTTGTGAAC No data
Right 994994362 5:107041006-107041028 TTGTGAACAGAGATGAACCTAGG No data
994994358_994994362 1 Left 994994358 5:107040982-107041004 CCATTACTTCCCCTAGAACAAAT No data
Right 994994362 5:107041006-107041028 TTGTGAACAGAGATGAACCTAGG No data
994994360_994994362 -9 Left 994994360 5:107040992-107041014 CCCTAGAACAAATTTTGTGAACA No data
Right 994994362 5:107041006-107041028 TTGTGAACAGAGATGAACCTAGG No data
994994361_994994362 -10 Left 994994361 5:107040993-107041015 CCTAGAACAAATTTTGTGAACAG No data
Right 994994362 5:107041006-107041028 TTGTGAACAGAGATGAACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994994362 Original CRISPR TTGTGAACAGAGATGAACCT AGG Intergenic
No off target data available for this crispr