ID: 994998459

View in Genome Browser
Species Human (GRCh38)
Location 5:107095806-107095828
Sequence GATATTTAACTGGGAAACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994998459_994998463 -10 Left 994998459 5:107095806-107095828 CCACTGTTTCCCAGTTAAATATC No data
Right 994998463 5:107095819-107095841 GTTAAATATCATGTTGGCTCTGG No data
994998459_994998464 -9 Left 994998459 5:107095806-107095828 CCACTGTTTCCCAGTTAAATATC No data
Right 994998464 5:107095820-107095842 TTAAATATCATGTTGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994998459 Original CRISPR GATATTTAACTGGGAAACAG TGG (reversed) Intergenic
No off target data available for this crispr