ID: 995001614

View in Genome Browser
Species Human (GRCh38)
Location 5:107138017-107138039
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995001609_995001614 6 Left 995001609 5:107137988-107138010 CCAGAGCAGAATGAGAAAGAAAT No data
Right 995001614 5:107138017-107138039 AAGGCTGTACACAGACATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr