ID: 995012444

View in Genome Browser
Species Human (GRCh38)
Location 5:107272884-107272906
Sequence ATGAACAAACGCCCCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995012442_995012444 20 Left 995012442 5:107272841-107272863 CCTTCATCAAAGCACAACAGTAG No data
Right 995012444 5:107272884-107272906 ATGAACAAACGCCCCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995012444 Original CRISPR ATGAACAAACGCCCCTTTGT GGG Intergenic
No off target data available for this crispr