ID: 995012820

View in Genome Browser
Species Human (GRCh38)
Location 5:107276882-107276904
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995012820_995012822 25 Left 995012820 5:107276882-107276904 CCTACTAAATTCAGTATGCGAGA No data
Right 995012822 5:107276930-107276952 TTAATGCAGTACCCATATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995012820 Original CRISPR TCTCGCATACTGAATTTAGT AGG (reversed) Intergenic
No off target data available for this crispr