ID: 995015764

View in Genome Browser
Species Human (GRCh38)
Location 5:107306906-107306928
Sequence ACGTTGGCAGAGATGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995015758_995015764 14 Left 995015758 5:107306869-107306891 CCAATGCTGGAATAATATGTGCA No data
Right 995015764 5:107306906-107306928 ACGTTGGCAGAGATGGAGGGAGG No data
995015756_995015764 16 Left 995015756 5:107306867-107306889 CCCCAATGCTGGAATAATATGTG No data
Right 995015764 5:107306906-107306928 ACGTTGGCAGAGATGGAGGGAGG No data
995015755_995015764 19 Left 995015755 5:107306864-107306886 CCACCCCAATGCTGGAATAATAT No data
Right 995015764 5:107306906-107306928 ACGTTGGCAGAGATGGAGGGAGG No data
995015757_995015764 15 Left 995015757 5:107306868-107306890 CCCAATGCTGGAATAATATGTGC No data
Right 995015764 5:107306906-107306928 ACGTTGGCAGAGATGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995015764 Original CRISPR ACGTTGGCAGAGATGGAGGG AGG Intergenic
No off target data available for this crispr