ID: 995015803

View in Genome Browser
Species Human (GRCh38)
Location 5:107307329-107307351
Sequence CAAGCTGGTCACTTGGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995015803_995015808 28 Left 995015803 5:107307329-107307351 CCTTGAGCCAAGTGACCAGCTTG No data
Right 995015808 5:107307380-107307402 GACCTTCATTTGAAAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995015803 Original CRISPR CAAGCTGGTCACTTGGCTCA AGG (reversed) Intergenic
No off target data available for this crispr