ID: 995018157

View in Genome Browser
Species Human (GRCh38)
Location 5:107336096-107336118
Sequence GGCACTCAACTTAGTGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995018150_995018157 21 Left 995018150 5:107336052-107336074 CCTGGATGCTAAACACCACGACC No data
Right 995018157 5:107336096-107336118 GGCACTCAACTTAGTGAGACTGG No data
995018154_995018157 -6 Left 995018154 5:107336079-107336101 CCTACCATCCTTGATGTGGCACT No data
Right 995018157 5:107336096-107336118 GGCACTCAACTTAGTGAGACTGG No data
995018152_995018157 0 Left 995018152 5:107336073-107336095 CCAATTCCTACCATCCTTGATGT No data
Right 995018157 5:107336096-107336118 GGCACTCAACTTAGTGAGACTGG No data
995018149_995018157 29 Left 995018149 5:107336044-107336066 CCAGAAAACCTGGATGCTAAACA No data
Right 995018157 5:107336096-107336118 GGCACTCAACTTAGTGAGACTGG No data
995018155_995018157 -10 Left 995018155 5:107336083-107336105 CCATCCTTGATGTGGCACTCAAC No data
Right 995018157 5:107336096-107336118 GGCACTCAACTTAGTGAGACTGG No data
995018151_995018157 6 Left 995018151 5:107336067-107336089 CCACGACCAATTCCTACCATCCT No data
Right 995018157 5:107336096-107336118 GGCACTCAACTTAGTGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995018157 Original CRISPR GGCACTCAACTTAGTGAGAC TGG Intergenic