ID: 995022310

View in Genome Browser
Species Human (GRCh38)
Location 5:107380572-107380594
Sequence GCCTCCTAGAAAAAAAAAAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3704
Summary {0: 1, 1: 0, 2: 20, 3: 345, 4: 3338}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995022305_995022310 9 Left 995022305 5:107380540-107380562 CCTGCTCTGTATTAGCATTCCAC 0: 1
1: 0
2: 2
3: 13
4: 193
Right 995022310 5:107380572-107380594 GCCTCCTAGAAAAAAAAAAAAGG 0: 1
1: 0
2: 20
3: 345
4: 3338
995022306_995022310 -10 Left 995022306 5:107380559-107380581 CCACACCCAACCTGCCTCCTAGA 0: 1
1: 1
2: 5
3: 35
4: 407
Right 995022310 5:107380572-107380594 GCCTCCTAGAAAAAAAAAAAAGG 0: 1
1: 0
2: 20
3: 345
4: 3338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995022310 Original CRISPR GCCTCCTAGAAAAAAAAAAA AGG Exonic
Too many off-targets to display for this crispr