ID: 995023214

View in Genome Browser
Species Human (GRCh38)
Location 5:107389880-107389902
Sequence CAGAAAATGAGGAAGTAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 410}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995023214 Original CRISPR CAGAAAATGAGGAAGTAGTG GGG (reversed) Intronic
900534137 1:3168720-3168742 CAGGGAATGAGGAGGGAGTGGGG + Intronic
900875063 1:5336516-5336538 GAGAAAATGAGGAAACAGAGAGG - Intergenic
901842249 1:11961006-11961028 CAGAGAAAGAGGAAGGACTGGGG + Intronic
902651816 1:17842368-17842390 AAGCAACAGAGGAAGTAGTGGGG - Intergenic
902729989 1:18362934-18362956 CAGAAACAGAGGCAGAAGTGGGG - Intronic
902752965 1:18530121-18530143 CAGACAGTGAGGAGGGAGTGTGG - Intergenic
904297051 1:29526610-29526632 CAGAAAATTAGAAAGTGATGAGG - Intergenic
904510706 1:31004438-31004460 CATAAGATGAGGAAAGAGTGAGG + Intronic
905337279 1:37253743-37253765 CAGAAACTGAGGGAGTAGGCTGG - Intergenic
906240222 1:44238257-44238279 CAGGCAATGAGGATGTTGTGGGG + Intronic
907073718 1:51560389-51560411 CATAAAATGAGGAAATAATAAGG + Intergenic
908975917 1:69898190-69898212 CAGAAAATAAGGAAGGTCTGGGG + Intronic
909643315 1:77889573-77889595 AAGAAAATGACGAAGTTGAGAGG + Intronic
909819827 1:80048060-80048082 CAGAAAAGGAGAAAGTAGCAGGG + Intergenic
911153191 1:94614982-94615004 CAGAAACTTAGGAAGCAGTGTGG + Intergenic
911786233 1:101951584-101951606 CAGAAAATGACTAAGTATTAGGG - Intronic
911950793 1:104171997-104172019 CAGAAAATGAGAAAAAAGTGTGG - Intergenic
912701918 1:111884417-111884439 CAGAAAGTTAGGAAGTCCTGGGG - Intronic
914204782 1:145517552-145517574 AAGAAGAAGAGGAAGGAGTGTGG + Intergenic
914370780 1:147022675-147022697 AAGAAGAAGAGGAAGGAGTGTGG - Intergenic
914483906 1:148090739-148090761 AAGAAGAGGAGGAAGGAGTGTGG + Intergenic
914689370 1:150011843-150011865 TAGAAACTGAGGAAGAAGTGAGG - Intergenic
915125032 1:153657972-153657994 CAGAAAATGAAAAATTAGTCAGG + Intergenic
915222429 1:154385659-154385681 CTGAAGAGGAGGAAGTAGAGAGG - Intergenic
915395865 1:155583535-155583557 CACAAAATAATAAAGTAGTGAGG + Intergenic
915411473 1:155704146-155704168 CACAAAATAATCAAGTAGTGAGG + Intronic
915487503 1:156232037-156232059 TAGAAACTGTGGAAGGAGTGAGG + Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917997737 1:180458536-180458558 CAGAAAGGGAGAAGGTAGTGTGG + Intronic
918032498 1:180829033-180829055 CAAAAAATGAAAAATTAGTGGGG + Intronic
918101650 1:181381492-181381514 GAGAAGATGAGGAAGTGGGGAGG + Intergenic
919710128 1:200718271-200718293 CAGAAAAAGTGAAATTAGTGAGG + Intergenic
920405838 1:205709687-205709709 CACAAAATGAGGATCCAGTGTGG + Intergenic
920633565 1:207677015-207677037 GAGAGAAAGAGGAAGTAGAGTGG + Intronic
920844115 1:209579216-209579238 CAGATAATGAGGAGGAAGAGGGG - Intergenic
921841440 1:219832966-219832988 TAGCAAAACAGGAAGTAGTGTGG + Intronic
922722703 1:227906699-227906721 CAGGAAAGGAGGAAGGAGAGTGG - Intergenic
922722723 1:227906776-227906798 CAGGAAAGGAGGAAGGAGAGTGG - Intergenic
923287450 1:232510007-232510029 CACAAAATGAGGGAGTGGGGAGG - Intronic
923371084 1:233313571-233313593 CAGAAAAAGAGAAAGTGGGGAGG + Intergenic
924121006 1:240798081-240798103 AAAAAAATGGGGAAATAGTGAGG - Intronic
924138864 1:241000950-241000972 GTGAAAATGAGGAACTAGTCAGG - Intronic
1062799439 10:368496-368518 CAGGGAATCAGGGAGTAGTGAGG + Intronic
1064814141 10:19237291-19237313 CAAACAGTGAGGAAGAAGTGGGG - Intronic
1065948995 10:30634443-30634465 CAGAAAATAAGGAAATGCTGCGG + Intergenic
1066657675 10:37711122-37711144 CAGAGACTGACCAAGTAGTGAGG + Intergenic
1067392653 10:45878755-45878777 GAGAAAATGATGAAGTAGATGGG + Intergenic
1067860980 10:49847871-49847893 GAGAAAATGATGAAGTAGATGGG + Intronic
1067988214 10:51177508-51177530 CAGAAAAAGAGGATGTGATGTGG - Intronic
1068671249 10:59725769-59725791 TACCAAATGAGGAAGCAGTGAGG + Intronic
1069239417 10:66121426-66121448 AAGAAACTGAGGAAATACTGAGG - Intronic
1070107674 10:73450748-73450770 CAGAAACTGAGGGAATAGAGAGG - Intronic
1070398769 10:76034746-76034768 CAGTAAATGAATAAATAGTGTGG + Intronic
1071918863 10:90326989-90327011 CAGAAACTGAGGAAGTTCTTAGG + Intergenic
1074993140 10:118729873-118729895 CAGCAAATTAGGAAGTGGGGTGG - Intronic
1075791514 10:125087604-125087626 GAGAAAATGAGGACTAAGTGGGG - Intronic
1075918564 10:126190695-126190717 CTGAAAATGAGAAGGTGGTGAGG + Intronic
1076079893 10:127569902-127569924 CAGACATGGAGGAAGGAGTGTGG + Intergenic
1076166344 10:128285427-128285449 AAGAAAATGAGGGATTCGTGGGG + Intergenic
1076558720 10:131347055-131347077 AAGAAAGGGAGGAAGGAGTGAGG - Intergenic
1077626314 11:3774921-3774943 CAGAAAATGAAGAATTTGTCAGG - Intronic
1078361982 11:10676191-10676213 CAGAAAGTGATGGAGGAGTGAGG + Intronic
1078414269 11:11152496-11152518 CAGAAAAAGAGAGAGAAGTGGGG + Intergenic
1078674922 11:13401559-13401581 TAGAGAAAGAGGAAGTAGAGTGG + Intronic
1079574562 11:21987305-21987327 CAGAAACTGAGGAGGTGATGGGG - Intergenic
1079834935 11:25322828-25322850 CAGAAATTGCGTAAGTAATGAGG + Intergenic
1080037786 11:27727398-27727420 GAGAAAATGAGGAGGCAGAGGGG + Intergenic
1081745418 11:45469451-45469473 GAGAAAATGAGGAAGGGGTCTGG - Intergenic
1083069989 11:59968419-59968441 CAGAAAATGAGCAGGTTGTGTGG - Intergenic
1084457125 11:69274308-69274330 CAGGAATTGAGGAAGGAGGGAGG + Intergenic
1084729923 11:71066286-71066308 CAGAGAGTGGGGAAGTTGTGGGG + Intronic
1084771954 11:71349186-71349208 GAGAAAATGAGGGAGGAGCGTGG + Intergenic
1085285158 11:75354849-75354871 CAGAAATGAAGGAAGTAATGGGG + Intergenic
1085931520 11:81089061-81089083 GAGAAAATGAAGATGGAGTGAGG - Intergenic
1087270945 11:96111050-96111072 CAGAAAATAAGGGAGTGGGGAGG + Intronic
1088718803 11:112573810-112573832 CAGCAGATGAGGTAGAAGTGAGG - Intergenic
1089614160 11:119685820-119685842 AAAACAATGAGCAAGTAGTGGGG - Intronic
1089828118 11:121297861-121297883 CAGAAACTTAGGAAGCAGTGTGG + Intronic
1090853752 11:130593756-130593778 GAGAAAATGAGGAAGGAGGTAGG + Intergenic
1093003617 12:14027689-14027711 AAGAAGATGTAGAAGTAGTGGGG + Intergenic
1093833679 12:23799113-23799135 CAGAAAATAAGGGAGTATTTTGG + Intronic
1096847615 12:54416762-54416784 CAAAAAACTAGTAAGTAGTGGGG + Intronic
1098570319 12:71980983-71981005 CAAATAATTAGGAAATAGTGTGG + Intronic
1098696442 12:73563317-73563339 CAGAAAATCACGAAGTTTTGGGG + Intergenic
1098910958 12:76207859-76207881 AATAAAGTGAGGAAGAAGTGAGG - Intergenic
1098952094 12:76650244-76650266 AAGAAAATGAAGGAGGAGTGAGG - Intergenic
1099058497 12:77875384-77875406 AAGATAATGAGTAAGAAGTGAGG - Intronic
1099664082 12:85604264-85604286 CAAAAAAAGAGGAGGTAGTGTGG - Intergenic
1099936223 12:89128988-89129010 TAGAAAATGAGGCAGTAAAGAGG + Intergenic
1100910391 12:99354465-99354487 CTCAACATGAGGAAATAGTGAGG - Intronic
1101111089 12:101486543-101486565 CAGAAATTACGGAAGAAGTGGGG + Exonic
1101245616 12:102881558-102881580 CATAAGATGAGCAAGTACTGGGG - Intronic
1102122906 12:110456677-110456699 AAAAAAAAGAGGAAGTAGTGGGG - Intronic
1102932496 12:116873532-116873554 CAAAAAATAAGAAATTAGTGAGG - Intronic
1104309932 12:127645374-127645396 CAAAAAAAGAGGACATAGTGGGG + Intergenic
1104524932 12:129512180-129512202 CTGAAACTCAGAAAGTAGTGGGG - Intronic
1105484297 13:20811734-20811756 CAGAAAACAAGGCAGTGGTGGGG + Intronic
1105811785 13:24001879-24001901 CAGAAGATGAGGCTGGAGTGTGG + Intronic
1106061958 13:26301997-26302019 CAGAAAGTGAGGCAAGAGTGCGG + Intronic
1106310329 13:28548622-28548644 AGGAAAGTGAGGAAGTAGTTAGG + Intergenic
1106822615 13:33482928-33482950 CAGAAAATCAGGTAGGAGGGAGG + Intergenic
1107739149 13:43431061-43431083 TAGAAAATAAGGAAATAGAGTGG + Intronic
1108039491 13:46326203-46326225 AAGAGAAGAAGGAAGTAGTGTGG + Intergenic
1108132602 13:47319019-47319041 AAGAAAATGAGGAAGTAGGAAGG - Intergenic
1108180819 13:47838082-47838104 CACAAGCTGAGGAAGGAGTGAGG - Intergenic
1108299876 13:49062506-49062528 CTGAAAAATAGGAAGTAGTGTGG - Intronic
1108871627 13:54993834-54993856 AAGAAAAAGAGAAAGTGGTGAGG + Intergenic
1109327600 13:60887616-60887638 CAGGTAATGCAGAAGTAGTGGGG + Intergenic
1109373688 13:61459626-61459648 CAGAAAATGAAGAAGGAAAGAGG - Intergenic
1111166354 13:84462646-84462668 CAGAAAATAAGGAGGAAGTTTGG - Intergenic
1111201591 13:84945032-84945054 CAGAAAAACAGGAATTAGGGAGG + Intergenic
1111433134 13:88170388-88170410 TAGAAAATGATGAAGTATAGAGG - Intergenic
1111614493 13:90645361-90645383 CAGACAATGAGGCATTAGTTAGG - Intergenic
1113207424 13:107933258-107933280 CAGAAAAGGAGGAGGAAATGAGG + Intergenic
1115163722 14:30424600-30424622 GAGAAAATGAGGCAGGGGTGGGG + Intergenic
1115636814 14:35297875-35297897 GAGAAATTGAGGAAGTGTTGGGG + Intronic
1117008882 14:51450166-51450188 AAGAAAATGAGATAGCAGTGAGG + Intergenic
1117393111 14:55281543-55281565 CAGAAAATGAAGAGGAAGGGTGG - Intronic
1118014584 14:61646110-61646132 CAAAAAAAAAGGAAGAAGTGTGG - Intronic
1118500758 14:66360404-66360426 AACAAAATGAGGAAGTAATTTGG + Intergenic
1119080670 14:71690719-71690741 ATAAAAATGAGGAAGAAGTGGGG - Intronic
1119674622 14:76544537-76544559 CAGAAAATGAAGAGATAGAGTGG + Intergenic
1120175698 14:81291034-81291056 CAGGATAGGAGGAAGTAGGGAGG + Intronic
1120390932 14:83908015-83908037 TAGAATATGAGTGAGTAGTGAGG - Intergenic
1120746070 14:88153100-88153122 CAGAAAAGGAGGAAGGTTTGAGG + Intergenic
1121856122 14:97271816-97271838 CAGAAAATAAGGACCTAGAGTGG - Intergenic
1121952348 14:98182760-98182782 CAGAACAGGAGGAGGTAGAGAGG - Intergenic
1122941337 14:104982727-104982749 CAGGAAATGTGGCAGTGGTGGGG + Intergenic
1124887333 15:33699301-33699323 GAGAAAGTGAGGAAAGAGTGAGG - Intronic
1125066206 15:35488264-35488286 CTGAAAATGTGGAAGTAGCTTGG - Intronic
1125173590 15:36794479-36794501 CATAAAAAGAGGAAGTAGAAAGG - Intronic
1125795697 15:42402613-42402635 CAGAAAAGGAAGAGGAAGTGAGG + Intronic
1125853510 15:42926702-42926724 TTTAAAATGAGAAAGTAGTGGGG + Intergenic
1127907411 15:63386176-63386198 CAGCCATTGAGGAAGTGGTGGGG - Intergenic
1128015140 15:64338249-64338271 CAGAAAGTAAAAAAGTAGTGAGG - Intronic
1129712643 15:77828429-77828451 CAGGAAATGAGGCAGGAGAGAGG - Intergenic
1131713730 15:95085297-95085319 CAACACATGAGGAATTAGTGGGG + Intergenic
1133443023 16:5836508-5836530 CAGAGAATAAGGAAGTATGGAGG - Intergenic
1135669244 16:24361252-24361274 TAGAAAATGTGGAGGTAATGGGG - Intronic
1137590003 16:49687639-49687661 CAGAAAATGAGGAACCAGGGGGG + Intronic
1138456532 16:57124381-57124403 CAGAAAATAGGAAAATAGTGAGG - Intronic
1138792704 16:59926304-59926326 AAAAAAATGAGGAAGTTCTGAGG - Intergenic
1138888815 16:61115679-61115701 CAGAAAATGAGGAGTTAGATAGG + Intergenic
1139173658 16:64662298-64662320 GAGAAAAGGAAGAAGTAGGGAGG - Intergenic
1139186761 16:64815066-64815088 CAAAAAATAAGGTACTAGTGAGG - Intergenic
1139389500 16:66597644-66597666 CATAAAATAAGGAAGTGGGGCGG + Intergenic
1140584102 16:76268173-76268195 CAGAAGATAGGGAAGCAGTGGGG + Intergenic
1142300329 16:89254081-89254103 CCCATAATGAGGAAGTGGTGAGG + Intergenic
1143654467 17:8285788-8285810 CCCAAAATGAGGAAGTTGGGGGG + Intergenic
1144425305 17:15135667-15135689 AAGAAGATGAGGAAGAGGTGAGG + Intergenic
1145352119 17:22092006-22092028 CAAAAAATGATGAAGAAGTTTGG + Intergenic
1145357934 17:22180660-22180682 CAGAACATGAGAAAGTTGTGTGG + Intergenic
1145993531 17:29093072-29093094 CTGATAATGAGGACGTGGTGAGG - Intronic
1146672380 17:34750368-34750390 CAGAAAACTAGGAAGTACTAGGG - Intergenic
1146821434 17:35986106-35986128 GAGAAATTGAGGGAGTAGAGAGG + Intronic
1149481113 17:57003827-57003849 GAGAAAATGAATGAGTAGTGAGG + Intronic
1150779004 17:68103596-68103618 GAGAAAATGAGGAAAAAGTAGGG + Intergenic
1153057235 18:958230-958252 AAGACAATGAGCAAGTACTGAGG - Intergenic
1153076869 18:1172906-1172928 CAGAAAATGACAAAGTTATGTGG + Intergenic
1153438897 18:5095431-5095453 CCCAAAATGAGGAAGAAATGAGG + Intergenic
1153724744 18:7943165-7943187 CAGAAAATCAGAAAGGAGTGGGG - Intronic
1155086256 18:22461581-22461603 CAGAAGATGAGAAAAAAGTGAGG + Intergenic
1157197245 18:45629480-45629502 CACACAATGATGAAGCAGTGAGG - Intronic
1158000421 18:52612116-52612138 GAGAAATTGAGTAAGTATTGGGG - Intronic
1158467807 18:57707008-57707030 AAGAAAATGAGGAAGCAGGCCGG + Intronic
1158606829 18:58902967-58902989 GAGAAAGTGAAGAAGTTGTGAGG - Intronic
1160003242 18:75047816-75047838 CAGCAAATGAGGAATTAATTCGG + Intronic
1160448565 18:78946782-78946804 CAGAAAAAGAGGGAGAAGAGGGG + Intergenic
1160892932 19:1388637-1388659 CAGAAAATAAGGAAGGGATGGGG - Intronic
1161289498 19:3485453-3485475 CAGAAAATTAGGTAGGTGTGGGG - Intergenic
1161459920 19:4390502-4390524 CAGAAAGAGAGGAAGAAGAGGGG + Intronic
1162043615 19:7984911-7984933 CAGAAAAGGAGGAGGTGGGGGGG + Intronic
1162187438 19:8916905-8916927 CAGAGAAGGAGGGAGGAGTGTGG + Intronic
1163059320 19:14747039-14747061 AAGGAAGTGAGGAAGTGGTGAGG - Intronic
1163210124 19:15834141-15834163 GAGAAACTGTGGAAGTAGGGAGG - Intergenic
1164302469 19:23973783-23973805 GAGAAAATGAGGAGGAAGAGAGG + Intergenic
1165053996 19:33162068-33162090 CAGAAAGTGAGGCCATAGTGTGG - Intronic
1165983365 19:39745833-39745855 GAGAAAAAGAGGAAGCAGTAAGG - Intergenic
1166099719 19:40564674-40564696 CAGAAAATGAAAAATTAGTTGGG + Intronic
1166722062 19:45002242-45002264 CAGAGAATGAGGAGGGGGTGGGG + Intronic
925243799 2:2360626-2360648 CAGACAGTGAGGAAGCAGGGGGG - Intergenic
926855570 2:17252251-17252273 GAGAAAATGAGGAGGGAGTCAGG - Intergenic
927487664 2:23499751-23499773 CAGGAGATGAGGGAGGAGTGGGG + Intronic
927539187 2:23892092-23892114 TAGGTAATGAGGAAGTAGTGAGG - Intronic
927826650 2:26313999-26314021 CAGAAACAGAGGAAGCAGTGGGG + Intronic
928369294 2:30729100-30729122 AGGATAATGAGGAAGAAGTGGGG + Intronic
928379494 2:30805356-30805378 GAGAAAAAGGGGAAGCAGTGAGG - Intronic
928599307 2:32887526-32887548 CAGAAAGTAAGGAAGTGCTGGGG + Intergenic
929181662 2:39046960-39046982 TCAAAAATGAGGAAGAAGTGAGG - Intronic
931232887 2:60389245-60389267 CAGGAGATGAGGCAGTTGTGTGG + Intergenic
931319078 2:61158684-61158706 CGGAAAATCAGGAAGTAGGGAGG + Intronic
931693245 2:64852962-64852984 AAGAAAAAGAGGAAGGAGAGGGG + Intergenic
931745836 2:65291307-65291329 CAAAATAAGAGGAAGTAGTCTGG + Intergenic
931939511 2:67236516-67236538 CAGATAATGACGATGTAATGAGG - Intergenic
933526106 2:83441648-83441670 CAGAAAAGTAGAAAGTAGTTTGG - Intergenic
935287418 2:101578082-101578104 CAGAAAATGAGAAAACCGTGAGG + Intergenic
935367831 2:102313628-102313650 CAGAAAACCAGGAAGTATGGAGG - Intronic
935729013 2:106049534-106049556 CAGGAAATGAGAAGGTTGTGGGG + Intergenic
936564489 2:113572442-113572464 GAGAAAATGAGTGAGCAGTGGGG - Intergenic
936637551 2:114276621-114276643 TAGAAATTTAGTAAGTAGTGAGG - Intergenic
937349224 2:121149919-121149941 CAGAAGATGAGCAAGAGGTGTGG + Intergenic
939129284 2:138214742-138214764 CAGAAAATCAGGAAGTAGCCAGG - Intergenic
939193973 2:138949659-138949681 CAGAAAGAGAGGAAGAGGTGTGG - Intergenic
939388562 2:141534900-141534922 GAGACAAAAAGGAAGTAGTGGGG - Intronic
939722450 2:145671318-145671340 AAGAAAATCAGGAAGTAGTAAGG + Intergenic
939805404 2:146769690-146769712 CAGAAAATGCTGGAGTAGAGGGG + Intergenic
940059032 2:149544747-149544769 CAGAAATTGAGGAATAAGAGTGG + Intergenic
940100112 2:150027477-150027499 CAGAATCTTAGGAAGTTGTGGGG - Intergenic
941963570 2:171277609-171277631 CAGAAAATGGCGAAGTTGTCAGG + Intergenic
942918254 2:181338765-181338787 CTGACATTGAGGAAGGAGTGGGG - Intergenic
943619979 2:190138565-190138587 AAGAAAATGAGCAAGGAGAGTGG - Intronic
943672688 2:190680317-190680339 CTGAAAAAGAGGGAGTGGTGAGG - Intronic
944984895 2:205165189-205165211 CAGAAAATCAGGAAGGAGATAGG + Intronic
948938491 2:241183964-241183986 CAAAAAATGTGGAAGTGATGAGG + Intergenic
1169147411 20:3261931-3261953 CAGAAAATGTGGAAGGAGGGTGG + Intronic
1169197461 20:3691265-3691287 CAGAAGAGGAGGAAGAACTGAGG + Intronic
1170181252 20:13532516-13532538 TAGAAAATCAGGAAAGAGTGTGG - Intronic
1171997083 20:31739754-31739776 CAGAAACTGAGGAAGGAGGAAGG + Intronic
1172321200 20:33996200-33996222 GACAGAATGAGTAAGTAGTGAGG + Intronic
1173174054 20:40750986-40751008 CAGCAGAGGTGGAAGTAGTGAGG + Intergenic
1173184128 20:40827365-40827387 GAGAAAATGAAGAAGTATTGAGG - Intergenic
1173333774 20:42097026-42097048 GAGAAAATGAGACAGCAGTGTGG + Intronic
1173386545 20:42593569-42593591 CAGCAAATGTGGAAATATTGAGG - Intronic
1173732043 20:45335831-45335853 CAGACGATGAGGATGTAGTGGGG - Exonic
1174208049 20:48855596-48855618 CAGAAAATAAGTAAGTAAAGAGG + Intergenic
1175343970 20:58256929-58256951 GAGCAAGAGAGGAAGTAGTGGGG - Intergenic
1176648889 21:9528353-9528375 CAAAAAATGATGAAGAAGTTTGG - Intergenic
1177014617 21:15770547-15770569 AGGAAAATGAGTAAGTAGTAAGG - Intronic
1177463920 21:21448802-21448824 CTGAAAATATGGAATTAGTGTGG - Intronic
1177745242 21:25204761-25204783 CAGAAAGAAAGAAAGTAGTGAGG + Intergenic
1177998642 21:28133370-28133392 GAGAATATGAGGGAGTGGTGGGG - Intergenic
1178940192 21:36899061-36899083 AAGAAAAAAAGGAAGTACTGTGG + Intronic
1178952808 21:36999024-36999046 AAGAAAATGAAGAAGTACTATGG - Intergenic
1180591444 22:16941026-16941048 CAGAAAAAGATGAAAAAGTGAGG - Intergenic
1181562842 22:23715631-23715653 CAGAAAAAGAGGATGTAGGCTGG + Intergenic
1181589954 22:23877821-23877843 CAGTCAATGAGGAGGTAGCGCGG - Exonic
1182198343 22:28542353-28542375 CAGAAGGTGAGGAAGGAGGGAGG + Intronic
1182210261 22:28670503-28670525 CATAAAAGGAAGAAGTACTGAGG - Intronic
1182451511 22:30424463-30424485 GAGAAAATGAGTAACTATTGAGG - Exonic
1182896162 22:33861099-33861121 AAGAAAAGGAGGAAGAAGAGAGG - Intronic
1183602394 22:38847511-38847533 CAAAACAAGAGGAAGTAGGGGGG + Intergenic
1184092469 22:42299787-42299809 CAGAGGAGGAGGAAGTGGTGGGG + Intronic
1184168548 22:42744821-42744843 CACCAAATGAGGACGGAGTGGGG - Intergenic
949135555 3:560858-560880 CAGAAAAAGAGAAGGTTGTGTGG + Intergenic
949170333 3:988829-988851 TAGAAGAAGAGGAAGAAGTGAGG - Intergenic
949984623 3:9530719-9530741 CTGTTAATGATGAAGTAGTGAGG - Intronic
949997083 3:9626604-9626626 CAGAGGCTGAGGAAGGAGTGAGG - Intergenic
950161376 3:10763680-10763702 CTGAAAATGAGGCAGTTGTGGGG - Intergenic
950282873 3:11721658-11721680 CAGGGAATGAGGAAGGAATGAGG + Intergenic
951532889 3:23714237-23714259 CAGAAAATAGGGCTGTAGTGAGG + Intergenic
951902079 3:27666822-27666844 CATGAAATGAGGAAGCAATGGGG + Intergenic
952009729 3:28886688-28886710 AAGAAAAAAAGGAAGGAGTGAGG - Intergenic
952321765 3:32284333-32284355 AAGAACAGGAGGAAGCAGTGAGG + Intronic
953073136 3:39543662-39543684 TAGAAAAAGAGGAAATACTGGGG + Intergenic
953178496 3:40574254-40574276 CAGAGAATGAGGGAGGAGGGAGG + Intronic
953475383 3:43201616-43201638 CAGAAACTGAGCAAGGATTGAGG + Intergenic
955594519 3:60574237-60574259 CAGAAAGTGAGAAAGAAGTCAGG - Intronic
955924894 3:63995205-63995227 CAGAATATAAGGAAGTACAGTGG + Intronic
956123033 3:65985059-65985081 CAGTAAATGAGGAAACACTGGGG - Intronic
956289723 3:67648750-67648772 CAGCAAATGAGGAAGAAGGAAGG - Intronic
956316287 3:67941336-67941358 AAGAAAAGGAGGAAGGAGAGGGG - Intergenic
957205273 3:77190044-77190066 ATGAAAAAGAGGAAGTAGTTTGG + Intronic
957617629 3:82551682-82551704 AGGAAAATGAGAAAGTAGAGGGG + Intergenic
958942740 3:100333543-100333565 TAGAAAATGAGGAAGTATTAGGG - Intergenic
960471965 3:118076442-118076464 CAGAGAATGAGGGAGGGGTGGGG + Intergenic
962499047 3:135970696-135970718 CCCAAAAAGAGGAAGTGGTGAGG + Intronic
962649838 3:137477458-137477480 CAGAGAATGAGGATGTAATGAGG - Intergenic
962884798 3:139614324-139614346 CAGAAAGTAGGGAAGTAGTCAGG - Intronic
963133465 3:141878498-141878520 CTGGAAATGAGGAAGCACTGGGG - Intronic
963509947 3:146234673-146234695 CAGAAAATGGGTAAGTAGCAAGG + Intronic
964003813 3:151807356-151807378 CAGAAAAGAAGGAAAGAGTGTGG + Intergenic
964413364 3:156422382-156422404 TGGTAACTGAGGAAGTAGTGAGG + Intronic
965341471 3:167497026-167497048 GAGAAAACAAGGAAATAGTGAGG - Intronic
965420181 3:168448373-168448395 CAGAAATTAAGAAAGTAGGGAGG - Intergenic
965534868 3:169813303-169813325 CAGGAAATCAGGAATTAGGGAGG + Intergenic
965897634 3:173596593-173596615 CACCAAATGAGTAAGTACTGGGG - Intronic
966327205 3:178770445-178770467 CAGAAGATGAGGACCAAGTGCGG + Intronic
966562215 3:181335535-181335557 CAAAACATGAGGGAGTAGTTGGG - Intergenic
967174691 3:186852595-186852617 CAGAAAATGAGAGAGAAGGGGGG + Intronic
967870866 3:194227857-194227879 CAGAAAAGGAGGAAGTTGGCAGG - Intergenic
968296181 3:197578070-197578092 CAGAACCTGAGGAAGTAGGAGGG - Intergenic
968441702 4:627693-627715 CAGAAAAGGAGGGAGGAGGGTGG - Intronic
971143700 4:23952391-23952413 CAGAAAACCAGGAAGTGGGGTGG + Intergenic
971304503 4:25467887-25467909 CAGAAAAGGAGCAAGAAGGGTGG - Intergenic
971813482 4:31458668-31458690 TGGAACATCAGGAAGTAGTGGGG - Intergenic
972447787 4:39162565-39162587 CAGAAAATGAGGCAGTAATCAGG + Intergenic
972650802 4:41015819-41015841 CAGAAACAGAGAATGTAGTGTGG + Intronic
974997486 4:69179235-69179257 CAGAAAATAAGGAACCAGTTAGG - Intronic
976089822 4:81445444-81445466 CAGAAAATGTGCAAATAGTATGG - Intronic
977242565 4:94590879-94590901 TAGAAAATGAAGAAGCAGGGAGG + Intronic
977472045 4:97453711-97453733 CTAAAAATGAGGAATTAGTGTGG + Intronic
977840118 4:101692736-101692758 CAAAAAATGAGTTAGTAGTTAGG - Intronic
978172764 4:105693504-105693526 CAGAAAATGATAAAGTAATGTGG + Intronic
978624053 4:110664481-110664503 CAGAGAAAGGGGAAGCAGTGAGG - Intergenic
979461796 4:120992232-120992254 CAGACGATGAGTAAGAAGTGTGG - Intergenic
983140162 4:164140531-164140553 CAGAGAAACAGGAATTAGTGAGG - Intronic
984095715 4:175430136-175430158 CAGAGAATGAGAAAGTAGGAGGG - Intergenic
985253601 4:188046939-188046961 AAGAAAAAGTTGAAGTAGTGTGG - Intergenic
985753667 5:1699776-1699798 CAGAAATTATGGAAGTCGTGGGG - Intergenic
985936781 5:3103398-3103420 AAGGTAATGAGGAAGTAATGAGG + Intergenic
985968439 5:3355643-3355665 CAGGAAAGGAGGAAAGAGTGAGG - Intergenic
986614855 5:9605693-9605715 GAGAAAATTAGAAAGAAGTGAGG + Intergenic
986859359 5:11907792-11907814 CAGACAATTAGGAAGAAATGAGG - Intergenic
986892388 5:12324792-12324814 CAGAGGCTGAGAAAGTAGTGGGG + Intergenic
991566573 5:68010931-68010953 CTGAAATTGAGGAAGTAGGGAGG + Intergenic
993568127 5:89500913-89500935 CAGACAATGAGGAAAATGTGAGG + Intergenic
993748019 5:91626006-91626028 CAGAGAAAGAGGAAATGGTGGGG - Intergenic
993875254 5:93299003-93299025 CAGAATATTAGGAAGAAATGTGG - Intergenic
993887832 5:93437577-93437599 CAGAAAATGAGAGAGTTGTGTGG - Intergenic
993967965 5:94381069-94381091 CAGAAAATGAGCAAGAAGGAAGG - Intronic
994975020 5:106791769-106791791 GAGAAAATGGGGAAGAAATGAGG - Intergenic
995023214 5:107389880-107389902 CAGAAAATGAGGAAGTAGTGGGG - Intronic
995283487 5:110360740-110360762 CAGAAATGGAAGAAGAAGTGGGG - Intronic
995397215 5:111699665-111699687 CAGAGAAGGAGGAACTGGTGGGG - Intronic
996992362 5:129650508-129650530 CAGAAAATAAGGAGGTAATCTGG - Intronic
997449494 5:133970347-133970369 CAGACAATAAGTAACTAGTGAGG + Intergenic
997775929 5:136604993-136605015 CAGAAAAAGAGGAAGGAAGGTGG - Intergenic
998053885 5:139057447-139057469 CAGGAAATGAGGAGGCAGGGAGG + Intronic
998743162 5:145228134-145228156 CAGAAAATGAGAATGTTGTATGG + Intergenic
998914064 5:146995289-146995311 CAGAAACTGGGCAAGTACTGGGG - Intronic
999392126 5:151201045-151201067 CACAAAATGGGTAGGTAGTGAGG - Intronic
999527145 5:152419408-152419430 GAGAAAATGAGGAAGAACAGTGG + Intronic
999631095 5:153572245-153572267 CAGAAAATCAGCAAATGGTGTGG + Intronic
999660971 5:153862527-153862549 CAGAAGAGGAGGAGGCAGTGAGG - Intergenic
1002014423 5:176308148-176308170 CAGAGAAGGAGGAAGTGATGGGG + Intronic
1002963647 6:1941381-1941403 CAGATGAGGAGGAAGCAGTGAGG + Intronic
1002986425 6:2193176-2193198 CAGGACTTGAGGAAGTTGTGAGG - Intronic
1003536558 6:6980622-6980644 CAGAAAATCTGGAACTATTGTGG - Intergenic
1004085168 6:12440527-12440549 CAGAAAATGGGGAACTATTGAGG - Intergenic
1004590177 6:17043039-17043061 CAGAAGATAAGGAAGGGGTGGGG - Intergenic
1005705938 6:28452986-28453008 CTGTAAATGAGGTAGCAGTGTGG + Intergenic
1006912963 6:37576000-37576022 CAGACAAAGAAGAAGGAGTGTGG - Intergenic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007488605 6:42200120-42200142 AAGAAAATGAGCAATGAGTGAGG - Intergenic
1008793366 6:55268255-55268277 CACAAAATAAAGCAGTAGTGAGG + Intronic
1009632639 6:66218392-66218414 TTGAAAATGAAGAATTAGTGAGG + Intergenic
1010298806 6:74233772-74233794 AAAGAAATGAGGAAGTAGTATGG + Intergenic
1010370679 6:75103476-75103498 CAGAACATGGGGAAGCAGAGGGG - Intronic
1010725387 6:79327117-79327139 CTGAAAATAAGGAAGTAGCACGG - Intergenic
1010855969 6:80839957-80839979 CAGAAAAGGAGAAAGTATTGGGG + Intergenic
1011794425 6:90937041-90937063 TATAAAATGAGGAAGAAGAGTGG + Intergenic
1011894960 6:92214491-92214513 CAGAATTGGAGGAAGAAGTGTGG - Intergenic
1012629135 6:101441892-101441914 CAGAACATAAGAAAGTAGTCTGG + Intronic
1013084972 6:106848804-106848826 CAGAGGATGAGGCAGGAGTGAGG + Intergenic
1013797628 6:113904811-113904833 AAGAACAAGAGGAATTAGTGTGG + Intergenic
1014592962 6:123295019-123295041 CAGGAAATGAGGAAGGAGGCAGG + Intronic
1014856007 6:126401772-126401794 CAGAAAAACAGGACATAGTGAGG - Intergenic
1015265956 6:131292732-131292754 TAGACAATCAGGAAGTAGGGAGG - Intergenic
1016316155 6:142789694-142789716 TTGAATAAGAGGAAGTAGTGTGG - Intronic
1016657635 6:146540254-146540276 CAGAAAATCAGGAAGGAGAATGG - Intergenic
1018816810 6:167338999-167339021 TAGAAAAGGAGGAAGGAGGGAGG - Intronic
1020395100 7:7706300-7706322 TAGAAGAGGTGGAAGTAGTGAGG + Intronic
1020447528 7:8284878-8284900 CAGCAAATAAGGAAATACTGGGG - Intergenic
1021089605 7:16467733-16467755 CAGAAAAAGAAAAAGTAGTGAGG - Intronic
1021255518 7:18387555-18387577 TAGAAAATGAGGAAGGAGGTAGG + Intronic
1021653267 7:22852037-22852059 CTGATAATGGGGCAGTAGTGGGG - Intergenic
1022046208 7:26624526-26624548 CAGAGAATGGGGAAGCAGAGTGG + Intergenic
1022158812 7:27687932-27687954 CAGAAAATGTGGAACTACTCAGG - Intergenic
1023526246 7:41106804-41106826 CAGAAAATCAGGAAAGAGTATGG - Intergenic
1023610825 7:41968564-41968586 AAGAAAATGTGGAAGGAGGGAGG - Intronic
1023643070 7:42280959-42280981 CAGAAAATGAAAAGGTAGTTGGG - Intergenic
1023892327 7:44401998-44402020 CAGAACATGAGGGAGGAGTGTGG - Intronic
1024246339 7:47472968-47472990 CAGAAGGTGAGGAAGGGGTGGGG - Intronic
1024710408 7:52009115-52009137 GAGAAAATGAGGAAGAAGGTGGG - Intergenic
1025275403 7:57578424-57578446 CAAAAAATGATGAAGAAGTTTGG - Intergenic
1026348771 7:69497654-69497676 CAGAAAAACAGGAATTAGAGAGG + Intergenic
1027470199 7:78564167-78564189 CAGATTATGAGGCAGTTGTGCGG - Intronic
1027480941 7:78695699-78695721 AAGAAAAGGAGGATTTAGTGGGG + Intronic
1028070769 7:86447326-86447348 CAGAACAGAAAGAAGTAGTGAGG + Intergenic
1028824150 7:95250036-95250058 CAGAAAATGAGAAAGTGAGGTGG + Exonic
1028980367 7:96961611-96961633 CATAAAATGAGGCATTATTGAGG - Intergenic
1030740890 7:113108583-113108605 TTGAAAATGAAGAAGTAGTTTGG + Intergenic
1031050184 7:116937029-116937051 AAGAAAATGATGAAGTTGTGTGG + Intergenic
1031747394 7:125518725-125518747 CAAAAAATGAGGAACAAGAGGGG + Intergenic
1033633899 7:143190057-143190079 CTGAAAATGAAAAAGTAATGAGG + Intergenic
1033860724 7:145623505-145623527 CAGAAAATTAGGAAAGGGTGAGG - Intergenic
1034089830 7:148353260-148353282 CAAAAGAGGAGGAAGCAGTGAGG + Intronic
1034222463 7:149457020-149457042 TGGGGAATGAGGAAGTAGTGAGG + Intronic
1034295259 7:149966776-149966798 AAGACAAAGAGGAACTAGTGAGG - Intergenic
1034810803 7:154130172-154130194 AAGACAAAGAGGAACTAGTGAGG + Intronic
1035109295 7:156467207-156467229 CAGGAAGTGAGGAAGTGATGTGG - Intergenic
1035476503 7:159147912-159147934 CAGGAAAGGAGGGTGTAGTGAGG - Intergenic
1035945356 8:3955634-3955656 CGGTGAAAGAGGAAGTAGTGAGG - Intronic
1036475319 8:9087842-9087864 CAGGAAATGAGGAAGAAGCAAGG - Intronic
1038076444 8:24080432-24080454 CAGAAAATGTAAAAGGAGTGAGG - Intergenic
1039269740 8:35867907-35867929 CAGGAAAACAGGAAGTAGGGAGG + Intergenic
1040341021 8:46441122-46441144 GAGAAAATGAGGCCGCAGTGTGG - Intergenic
1040365268 8:46708976-46708998 CAGAAAAGGAGCAAACAGTGGGG - Intergenic
1040435463 8:47386846-47386868 CAGAAAATAAGGAGGAAGTGGGG + Intronic
1040794775 8:51277122-51277144 CAGAAAACCTGGAAGTAGAGTGG + Intergenic
1041177038 8:55207557-55207579 CAGTAATTGAGGAAGGATTGGGG - Intronic
1041903435 8:63007317-63007339 GAGGAAGTGAGGAAGTAGTCAGG + Intergenic
1042464481 8:69111709-69111731 CAGAAAATAAGTAGATAGTGTGG - Intergenic
1043674004 8:82926120-82926142 GAGAAAATGATGAAGAATTGGGG + Intergenic
1043719701 8:83532392-83532414 CAGAAAAACAGGAATTAGGGAGG - Intergenic
1045749816 8:105470163-105470185 AAGAAAAAGAGGAGGTAGAGGGG - Intronic
1045874716 8:106965674-106965696 CAGAAAGTGAGATAGGAGTGGGG + Intergenic
1045986311 8:108253375-108253397 CAGGAAAAGAGGCAGAAGTGAGG + Intronic
1046049812 8:109009539-109009561 CAGAAAAGGAGCAAGAAGTCAGG - Intergenic
1046184183 8:110691251-110691273 TTGTAAATGAGGAAGTTGTGTGG - Intergenic
1046769180 8:118101350-118101372 CAGAAAAGGAGAAATTTGTGAGG - Intronic
1047228761 8:122978339-122978361 GAAAGAATGAGGAAGTGGTGAGG - Intergenic
1048132703 8:131715426-131715448 CATGCAATCAGGAAGTAGTGAGG - Intergenic
1048738683 8:137530791-137530813 CTGAAAATGTGGAAGTAGCTTGG + Intergenic
1049887931 9:40766-40788 GAGAAAATGAGTGAGCAGTGGGG + Intergenic
1050413305 9:5388578-5388600 CTTAAAATGAGGAAGTAGAGAGG + Intronic
1050507732 9:6364941-6364963 CAGAGAATGAGGGAGTAAGGAGG + Intergenic
1050909489 9:11050118-11050140 CAGAAAAAGTGGAAAAAGTGAGG - Intergenic
1051344855 9:16142682-16142704 CAGAAAATGACAAATTTGTGAGG + Intergenic
1052211374 9:25907573-25907595 AAGAGGATGAGGAAGTAGAGTGG + Intergenic
1052398065 9:27965437-27965459 GAGAAAATGAGAAAATTGTGTGG - Intronic
1053056659 9:34996988-34997010 CAGAAAGTGAGGAAAAGGTGGGG - Intronic
1054826946 9:69582745-69582767 CAGGAAATGAGCAAGTAATGGGG - Intronic
1054902457 9:70383522-70383544 CAGAAAATGTGTAGGGAGTGTGG - Intergenic
1055679302 9:78698511-78698533 CAGCAAATCAGGAAGTTGTTGGG - Intergenic
1056234790 9:84584044-84584066 CAAAGAATGAGGAAGGAGTTAGG - Intergenic
1056508579 9:87281158-87281180 CAGAAAAGGAGGAGATAATGAGG + Intergenic
1056696701 9:88862476-88862498 CAGAAAATGATAAAGTAGAATGG + Intergenic
1057827729 9:98383581-98383603 CAGTAACTGAGGGGGTAGTGAGG - Intronic
1058419855 9:104823179-104823201 CAGGAACTGAGGAAGAAGGGAGG + Intronic
1058426705 9:104881724-104881746 CAGTAAATAAGGAAGGACTGAGG + Intronic
1059396350 9:114036401-114036423 CAGGAACTGAGGAAGGAGAGGGG - Intronic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1060846282 9:126840014-126840036 CAGAAAGTGAAGTAGTGGTGGGG + Intergenic
1061124168 9:128663301-128663323 CAGAAGAAGAGGAAGGAGTGGGG - Intergenic
1062065168 9:134522777-134522799 TAAAAAATGAGGAAGGGGTGAGG - Intergenic
1203626625 Un_KI270750v1:31902-31924 CAAAAAATGATGAAGAAGTTTGG - Intergenic
1186303340 X:8226037-8226059 CAGAAAATTAAAAAGTTGTGTGG - Intergenic
1186903369 X:14083493-14083515 CAGAAAAGGGGGAGGGAGTGTGG - Intergenic
1186947662 X:14587050-14587072 AAGTAAATGAGGAATTAATGTGG - Intronic
1187282950 X:17875571-17875593 CAGAAAAAGAGGAAAAAGAGTGG - Intergenic
1187725113 X:22194330-22194352 CAGAAAATCAGAAAGGAGAGAGG - Intronic
1188608543 X:32066445-32066467 CAGAAAAGCATGAAGTAGTAAGG - Intronic
1189334844 X:40164922-40164944 CAGAGAAGGAGGAAATGGTGGGG - Intronic
1189665735 X:43352861-43352883 TAGAAAAGGAGGAAGCAGTGAGG - Intergenic
1189698778 X:43694637-43694659 GAGAAAATGAGGAAGCAAAGGGG - Intronic
1190525921 X:51329658-51329680 GAGAAAATGAGGACTTAGAGTGG - Intergenic
1190543556 X:51502003-51502025 GAGAAAATGAGGATTTAGAGTGG + Intergenic
1190959026 X:55227250-55227272 CAGAAAATTGGGGAGGAGTGGGG + Intronic
1190963885 X:55279359-55279381 CAGAAAAAGAGAAAGGAATGAGG + Intronic
1191665942 X:63702765-63702787 CAGAAAATGCAGAAGTAGCCTGG + Intronic
1191968032 X:66782401-66782423 AAGAAATTGAGGAAGTTGGGGGG + Intergenic
1192537315 X:71939184-71939206 CAGAAAGTTAGGAGGTAGAGGGG + Intergenic
1193253648 X:79321850-79321872 AACAAAATAAGAAAGTAGTGAGG + Intergenic
1193431995 X:81419115-81419137 CAGCAAAAGAGGAAGCAGAGAGG - Intergenic
1194570915 X:95553692-95553714 CAGAAAATGAGGTAGGAGGTGGG - Intergenic
1195591766 X:106637163-106637185 GAGAGAGTGAGGAAGTAGTGTGG + Intronic
1196015752 X:110938515-110938537 AAGAAATTCAAGAAGTAGTGTGG + Intergenic
1198978001 X:142358910-142358932 CAAAAAATGAGGAACCATTGAGG - Intergenic
1199084794 X:143616176-143616198 CAGAAAACTAGGAAGCTGTGGGG - Intergenic
1200310421 X:155071613-155071635 CAGAGAAGGAGGAAGTAATGGGG + Exonic
1201186692 Y:11411756-11411778 CAAAAAAGGATGAAGCAGTGAGG + Intergenic
1201575862 Y:15460862-15460884 CAGAAAATGAGGAAGAAAGGAGG - Intergenic