ID: 995024682

View in Genome Browser
Species Human (GRCh38)
Location 5:107406238-107406260
Sequence ATGTATACAAATATTAATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 838
Summary {0: 1, 1: 0, 2: 5, 3: 62, 4: 770}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995024682 Original CRISPR ATGTATACAAATATTAATTG TGG Intronic
900665177 1:3810440-3810462 ATATATACAAAAATTAGCTGGGG + Intergenic
901386543 1:8913195-8913217 ATGTTTACAAAGATTAAATGGGG + Intergenic
902989379 1:20175584-20175606 ATTTAAAAAAATAATAATTGAGG - Intronic
903727942 1:25465622-25465644 ATTTATACAAATTTTAAAAGTGG - Intronic
904022326 1:27476752-27476774 ATTTCTAAAAATGTTAATTGTGG - Intronic
905661677 1:39731896-39731918 TTCTATACAAAAATTAATTTGGG - Intronic
906513580 1:46424991-46425013 ATGTGTATTAATATTAATTAGGG + Intergenic
906862501 1:49376592-49376614 CTGTTTACAAATATTAGTTCAGG - Intronic
908051891 1:60242080-60242102 ATTTATACAAGTATAAATTCTGG - Intergenic
908240626 1:62186291-62186313 AGTTATATAAAAATTAATTGGGG - Intergenic
908339873 1:63166056-63166078 ATGTATAAAATTATAAATTTTGG - Intergenic
908504537 1:64783178-64783200 ATGCACACATATATTTATTGCGG - Intronic
908884256 1:68769674-68769696 ATTTCTATAAATATTAGTTGTGG - Intergenic
909771518 1:79428644-79428666 TTGTATACAAATGTTCATAGAGG + Intergenic
910090434 1:83456547-83456569 ATGTTTACAAAAATTACATGAGG - Intergenic
910135637 1:83965751-83965773 ATTTAAATAAATAATAATTGGGG - Intronic
910231328 1:84990503-84990525 AGTTATAGAAATGTTAATTGCGG + Intronic
911252918 1:95598880-95598902 ATGTCCACAAATATTACTGGTGG - Intergenic
911323429 1:96441459-96441481 ATTAATACATATATTAATTAGGG - Intergenic
911775118 1:101799768-101799790 ATGTTTTCAAGTCTTAATTGTGG + Intergenic
911791312 1:102018956-102018978 ATGCACACATATATTTATTGTGG + Intergenic
911836327 1:102623665-102623687 GATTATACAAATATTCATTGTGG + Intergenic
911891388 1:103377003-103377025 ATGTACACATATGTTTATTGAGG + Intergenic
912007608 1:104923401-104923423 AAGTCTGCAAATGTTAATTGTGG + Intergenic
912742850 1:112217337-112217359 ATGCACACATATATTTATTGTGG + Intergenic
912872207 1:113318708-113318730 ATGCACACATATATTTATTGCGG + Intergenic
912908431 1:113732007-113732029 ATGTATACATATATTTTTGGAGG - Intronic
913024514 1:114823564-114823586 AAGTATAAAAGTATTAATTTGGG - Intergenic
913156992 1:116109395-116109417 ATAAACACAAATATTTATTGAGG + Intergenic
913173361 1:116252127-116252149 CTGTAGACAAATGTTAATAGTGG + Intergenic
913204424 1:116523603-116523625 AAGTATACAAACACTACTTGGGG - Intronic
913649888 1:120903231-120903253 ATGCACACATATGTTAATTGTGG + Intergenic
915682260 1:157592779-157592801 ATGTACACATATGTTTATTGTGG + Intronic
915690258 1:157681690-157681712 ATGCATACATATGTTTATTGTGG - Intronic
916868232 1:168884457-168884479 ATGCATACATATGTTTATTGCGG - Intergenic
916983416 1:170164891-170164913 CTGTGTATAAATAATAATTGTGG + Intronic
917143592 1:171863432-171863454 AAGTATACAAAGACTATTTGAGG + Intronic
917511390 1:175672032-175672054 CTTTATTCAAATATTTATTGGGG - Intronic
917758579 1:178130712-178130734 ATGTAATCAAATATTAATCTTGG + Intronic
917773449 1:178306345-178306367 ATGCATACATATGTTTATTGCGG - Intronic
918465472 1:184817320-184817342 ATGCACACATATGTTAATTGCGG - Intronic
919063415 1:192663407-192663429 ATGCACACATATATTTATTGTGG - Intergenic
919204386 1:194402535-194402557 ATCTATATAAATATGATTTGTGG + Intergenic
919710229 1:200719803-200719825 ATGAATTCAGAGATTAATTGGGG - Intergenic
920085933 1:203416948-203416970 CCTTATACAAAAATTAATTGAGG + Intergenic
920088729 1:203437187-203437209 ATGCACACATATATTTATTGAGG + Intergenic
920177530 1:204112279-204112301 AAAAATACAAATATTAGTTGGGG + Intronic
920245064 1:204581419-204581441 ATATATCAAAATATTAACTGTGG - Intergenic
920909416 1:210201392-210201414 ATGTATACAAATGTTACTAGAGG - Intergenic
921405840 1:214778537-214778559 ACGTAAACATATTTTAATTGAGG - Intergenic
921482154 1:215675736-215675758 AAGTATTCTGATATTAATTGGGG + Intronic
921597886 1:217074511-217074533 ATGAATATAAATATTACTTTTGG + Intronic
921754668 1:218840760-218840782 ATTTATAGAAATAATTATTGAGG - Intergenic
922611160 1:226929785-226929807 ATGCACACAAATGTTTATTGTGG + Intronic
922694558 1:227722364-227722386 AATTATACAAGTATTAATTTGGG - Intergenic
923223211 1:231915146-231915168 TTTTAAACAAATATTATTTGGGG - Intronic
923355370 1:233149881-233149903 ATTTATATATATATAAATTGAGG - Intronic
923416247 1:233764617-233764639 ATGCATACATATGTTTATTGTGG - Intergenic
923721419 1:236470168-236470190 TTGTATACACAGATTAAATGCGG - Intronic
923945551 1:238882954-238882976 ATGTATGCAATATTTAATTGAGG + Intergenic
1063002393 10:1936661-1936683 ATTTATTCAAATATTAATACAGG + Intergenic
1063525881 10:6784808-6784830 ATGTATTCAAATGTTAAGTAAGG - Intergenic
1064386940 10:14903471-14903493 AAGTATAAAAATATTAAATCTGG - Intronic
1064577502 10:16761100-16761122 AAATATACAAAAATTAAGTGTGG - Intronic
1065056385 10:21847369-21847391 ATGCATACATATATTAAATCAGG + Intronic
1065158864 10:22898250-22898272 ATTTTCACAATTATTAATTGTGG - Intergenic
1065473466 10:26108626-26108648 ATCTTTACAAATATTACTTTTGG - Intronic
1065581945 10:27180877-27180899 ATGAACAGAAATATTAATTGTGG - Intronic
1066155842 10:32676913-32676935 ATGCACACATATATTTATTGCGG + Intronic
1066617629 10:37311620-37311642 ATGTTTTCAAATATTTACTGAGG + Intronic
1066821043 10:39490049-39490071 ATGCACACATATATTTATTGTGG - Intergenic
1067194424 10:44103419-44103441 ATGAATACAAACAGTACTTGGGG + Intergenic
1067579003 10:47428038-47428060 ATGCATACATATGTTTATTGCGG - Intergenic
1068275776 10:54793633-54793655 ATATATACATATATAAATTATGG - Intronic
1068340308 10:55693073-55693095 ATGGATAGACATATTAAGTGGGG + Intergenic
1068415644 10:56718162-56718184 ACGTTTACAAATAAAAATTGGGG - Intergenic
1068444190 10:57098959-57098981 ATGTATACAAATATGATTCAGGG + Intergenic
1068493303 10:57751682-57751704 ATGTATAAAAATGTTTATTTTGG - Intergenic
1068637773 10:59366843-59366865 ATGTACACTAGCATTAATTGGGG - Intergenic
1069040648 10:63692296-63692318 ATGTTCACACATATGAATTGAGG - Intergenic
1069119682 10:64554462-64554484 ATGTAATAAAATATTAATTAGGG - Intergenic
1070173725 10:73952779-73952801 ATGTATACATATTTTTATTTTGG + Intergenic
1070571590 10:77643615-77643637 ATATATAAAAATATTAATAGTGG - Intergenic
1071163655 10:82780169-82780191 ATGTACACATATGTTTATTGTGG - Intronic
1071858797 10:89651636-89651658 ATGTAAAGAAATATAATTTGAGG + Intergenic
1072774538 10:98177478-98177500 ATGCATACATATGTTTATTGAGG - Intronic
1073182338 10:101591985-101592007 ATGTATAAAAATATAAATTATGG - Intronic
1073961408 10:108934138-108934160 ATGTATATATATATAAATTATGG + Intergenic
1074840114 10:117342789-117342811 ATGATTAGAAAGATTAATTGTGG - Intronic
1075459100 10:122604184-122604206 AATTATAAAAATATTAATTTGGG + Intronic
1075459732 10:122608243-122608265 AATTATAAAAATATTAATTTGGG + Intronic
1075460364 10:122612302-122612324 AATTATAAAAATATTAATTTGGG + Intronic
1075460996 10:122616361-122616383 AATTATAAAAATATTAATTTGGG + Intronic
1075491310 10:122872479-122872501 ATGCACACATATATTTATTGTGG + Intronic
1075497978 10:122944068-122944090 ATGCACACATATATTTATTGTGG + Intronic
1076965773 11:82802-82824 ATGCATACATATGTTTATTGTGG + Intergenic
1077732401 11:4746535-4746557 ATGAATAAGAATATAAATTGGGG + Intronic
1077957293 11:7034661-7034683 ATATCTTCAAATATTCATTGTGG + Intronic
1078385237 11:10885015-10885037 AATTATAAAAATATTAATTTTGG + Intergenic
1078574908 11:12492523-12492545 AGCTATAGAAATATTATTTGAGG + Intronic
1078690511 11:13575450-13575472 ATGTACACATATGTTTATTGTGG + Intergenic
1078840103 11:15070425-15070447 AATTATAAAAGTATTAATTGGGG + Intronic
1079596417 11:22253992-22254014 AAGTATACAATTAATTATTGTGG - Intronic
1079606177 11:22370198-22370220 ATGTATTCTTATATAAATTGTGG + Intronic
1079889807 11:26037235-26037257 ATGCATGCAAATATTTATTAAGG + Intergenic
1080137438 11:28872323-28872345 ATGTAAACAATAATTATTTGGGG - Intergenic
1080595569 11:33771773-33771795 ATGTTTACAAAAGTTAATTTGGG - Intronic
1081007139 11:37758805-37758827 ATGTAGATAAATATTAATTTTGG - Intergenic
1081413248 11:42784544-42784566 ATGAATACAAATATTGGTTGAGG - Intergenic
1082056621 11:47823017-47823039 ATGCACACATATATTTATTGTGG - Intronic
1082298557 11:50475406-50475428 ATGCACACATATATTTATTGTGG + Intergenic
1083117401 11:60475475-60475497 ATGCATACATATGTTTATTGCGG + Intergenic
1083194770 11:61079265-61079287 ATGTAGAAAAAAATTAAATGTGG - Intergenic
1083788391 11:64967857-64967879 AAATAAACAAATATAAATTGAGG + Intronic
1084857528 11:71998563-71998585 ATGCATGCATATATTAAGTGTGG - Intronic
1084990597 11:72920759-72920781 ATGTAGTAAAACATTAATTGAGG - Intronic
1084992954 11:72946089-72946111 ATGCATACATATGTTTATTGTGG + Intronic
1085565467 11:77509338-77509360 ATTTATAAAATTATTAATTTGGG - Intergenic
1085679458 11:78558881-78558903 ACGTCCACAAATATTAACTGTGG + Intronic
1086417508 11:86603638-86603660 ATGCATACATATGTTTATTGCGG + Intronic
1086426610 11:86690042-86690064 ATCTATAAAAATTTTAAATGTGG - Intergenic
1086538265 11:87876427-87876449 AGATATACAAAAATTTATTGGGG - Intergenic
1086627340 11:88972521-88972543 ATGGATACATATATAAATTGGGG + Intronic
1086644691 11:89204998-89205020 ATGTTTATAATTATTCATTGAGG - Intronic
1086777699 11:90860051-90860073 ATGCACACATATATTTATTGCGG + Intergenic
1086779382 11:90883115-90883137 ATGCACACATATATTTATTGTGG + Intergenic
1087086124 11:94220472-94220494 AATTATAAAAATATTAATTTGGG + Intergenic
1087216277 11:95498611-95498633 ATTTTAACAAATATTTATTGGGG + Intergenic
1087758555 11:102080699-102080721 ATGTATATAAAAACTATTTGTGG - Intronic
1088141646 11:106624043-106624065 ATATTTACACATATTTATTGTGG - Intergenic
1089130655 11:116209331-116209353 ATGCATTCAAATATTAACAGTGG - Intergenic
1092314395 12:7395137-7395159 ATGTACACATATGTTTATTGCGG + Intronic
1092664341 12:10778632-10778654 ATGAATTTATATATTAATTGTGG - Intergenic
1093479766 12:19592625-19592647 ATGTTTTCAAATATTATTTTGGG - Intronic
1093519968 12:20037611-20037633 CTGTGGACAAATATTGATTGTGG - Intergenic
1093873555 12:24321295-24321317 TTCTACACAAATATAAATTGTGG - Intergenic
1094079327 12:26515758-26515780 ATGGATACAAATATGAACTGCGG - Intronic
1094373472 12:29764305-29764327 CTTTATACAAATATTATTGGTGG - Intronic
1094529822 12:31263621-31263643 ATGTATACAACCATAAAATGTGG - Intergenic
1095239302 12:39838034-39838056 ATGCACACATATATTTATTGTGG + Intronic
1095280526 12:40347121-40347143 AACTACACCAATATTAATTGCGG - Intronic
1095861475 12:46922651-46922673 ATATACACAATTATTAATAGGGG - Intergenic
1096150762 12:49310445-49310467 ATGTACACATATGTTTATTGCGG - Intergenic
1097562199 12:61221335-61221357 ATGCACACATATATTTATTGTGG - Intergenic
1098299681 12:69041585-69041607 ATATATACACATATTTATTCAGG + Intergenic
1098673868 12:73265338-73265360 ATGTATACAAATTATTATTGTGG - Intergenic
1098706446 12:73696860-73696882 ATATTTCCCAATATTAATTGTGG + Intergenic
1099045103 12:77707509-77707531 ATGCACACATATATTCATTGTGG - Intergenic
1099061799 12:77920267-77920289 CTTTATTCAAATATTAATTATGG - Intronic
1099082421 12:78202359-78202381 TAGTAAACAAATATTAAATGAGG - Intronic
1099106004 12:78497122-78497144 ATGCACACATATATTTATTGCGG - Intergenic
1099203642 12:79703692-79703714 ATGGACATAAATATTTATTGTGG + Intergenic
1099601781 12:84748862-84748884 ATATATACAAATCTTAACTTTGG + Intergenic
1100254370 12:92867612-92867634 ATGTGCACAAATAATAAATGAGG - Intronic
1102291468 12:111703898-111703920 ATATATATATATATAAATTGTGG - Intronic
1104071289 12:125348252-125348274 ATGGATTAAAATAATAATTGTGG + Intronic
1104199940 12:126578755-126578777 ATTTATATAAATTTAAATTGAGG - Intergenic
1104419641 12:128624725-128624747 AAGTATTCAGATATTATTTGTGG + Intronic
1104691705 12:130831222-130831244 TTCCATACAAATAATAATTGTGG + Intronic
1105247183 13:18664773-18664795 ATATATACAAACATTTTTTGGGG - Intergenic
1105640250 13:22255006-22255028 AAGAATAAAATTATTAATTGTGG + Intergenic
1105954990 13:25273416-25273438 TTTTATACAAATTTTAATTAGGG - Intronic
1106334605 13:28772261-28772283 AGGTATTCAAATATGAATAGAGG - Intergenic
1106853689 13:33823335-33823357 ATGTACAGAGATATTAATTGTGG + Intronic
1106961109 13:34998964-34998986 AATTATAAAAATATTAATTTGGG + Intronic
1106991170 13:35422596-35422618 ATGCACACATATGTTAATTGTGG - Intronic
1107233634 13:38141720-38141742 ATGAATAGAGATATTAAATGAGG - Intergenic
1107365799 13:39673760-39673782 ATATACCAAAATATTAATTGTGG - Intronic
1107623345 13:42257190-42257212 ATGTATACAAATTTTTATTGTGG - Intergenic
1107810386 13:44194663-44194685 ATGCACACATATATTTATTGCGG - Intergenic
1108133446 13:47328974-47328996 ATATATACATATATTTTTTGGGG + Intergenic
1108170841 13:47740427-47740449 ATGTACACATATGTTTATTGCGG + Intergenic
1108170919 13:47741153-47741175 ATGTACACATATGTTTATTGCGG + Intergenic
1108811755 13:54233841-54233863 ATTTATATAAATATTCTTTGTGG - Intergenic
1109050858 13:57479476-57479498 ATGCACACATATATTTATTGTGG + Intergenic
1109270959 13:60254512-60254534 ATGTATACGTATGTTTATTGTGG + Intergenic
1109738008 13:66512112-66512134 ATGAATACAAATATGATTTAAGG - Intronic
1110367470 13:74702961-74702983 ATTTATATAAATATAAAATGAGG + Intergenic
1111267959 13:85843988-85844010 ATGCATACATATGTTTATTGCGG + Intergenic
1111531886 13:89547592-89547614 ATGAATCTAAATATTAATTTGGG - Intergenic
1111589029 13:90320040-90320062 ATGTATACATCTAATAAGTGAGG - Intergenic
1111648258 13:91058999-91059021 ACATACACAAATATTCATTGTGG + Intergenic
1112157569 13:96834235-96834257 ATGTATACAAAATATATTTGAGG + Exonic
1112544817 13:100356755-100356777 TTGTATACAAATGTTTATAGTGG + Intronic
1112721181 13:102247782-102247804 ATGCACACATATGTTAATTGCGG + Intronic
1112749999 13:102572914-102572936 ATGCATCCAGATATTAATTGAGG + Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112801686 13:103118241-103118263 ATGCACACATATATTTATTGTGG - Intergenic
1112817591 13:103291168-103291190 ACGAACACAAACATTAATTGGGG + Intergenic
1112863076 13:103858569-103858591 AAGTCTGCAAATATTAATAGGGG + Intergenic
1112886783 13:104183495-104183517 ATGCACACATATATTTATTGCGG - Intergenic
1112995147 13:105565391-105565413 ATTTGTACAAATATTCATTTGGG + Intergenic
1113221508 13:108108987-108109009 ATGTTTAAGAATATTCATTGTGG - Intergenic
1113640899 13:111956054-111956076 ATTTACACACATTTTAATTGGGG + Intergenic
1114044210 14:18707812-18707834 ATGCACACATATATTTATTGTGG + Intergenic
1114131419 14:19797541-19797563 ATTTTTTCAAATCTTAATTGTGG + Intronic
1114152593 14:20061326-20061348 ATTTATACTATTATTAAATGAGG + Intergenic
1114157342 14:20119475-20119497 AATTATACAAATATTAATTTGGG + Intergenic
1114339790 14:21731069-21731091 AATTATACAAGTATTAATTTGGG + Intergenic
1114457224 14:22863819-22863841 ACATATACAAAAATTAATTAAGG - Intergenic
1115048126 14:29023280-29023302 ATGCACACATATATTTATTGTGG - Intergenic
1115179826 14:30610600-30610622 ATGTATACATTTATTTATTTGGG - Intronic
1115481016 14:33860996-33861018 ATGCATACATATGTTTATTGCGG - Intergenic
1115732574 14:36287304-36287326 ATGTGTACCAATATTAAGAGTGG + Intergenic
1115983473 14:39079375-39079397 GACAATACAAATATTAATTGTGG - Intronic
1116127795 14:40811279-40811301 GTGTATACATATATTAGTTTGGG + Intergenic
1116152805 14:41163891-41163913 AAATATATAAATAATAATTGTGG - Intergenic
1116305181 14:43244685-43244707 CTGTATACAAAAATTAACTCAGG - Intergenic
1116515048 14:45795058-45795080 ATGCATACATATGTTTATTGCGG - Intergenic
1116686745 14:48049889-48049911 ATGTATTAGAATATTAATTTAGG + Intergenic
1116947099 14:50846030-50846052 ACGTGCACAAATATTAAATGAGG + Intergenic
1118216394 14:63812544-63812566 AATTATAAAAATATTAATTTTGG + Intergenic
1118939681 14:70321483-70321505 ATGCATACATGTATTTATTGTGG - Intergenic
1118948288 14:70409403-70409425 AAGTACACAATTATTTATTGAGG - Intronic
1119010903 14:70987472-70987494 ATGTATACAAAAATTATATATGG - Intronic
1119869224 14:78001003-78001025 AAGTATAAAAGTATTAATTTGGG - Intergenic
1120261725 14:82193832-82193854 ATTAATAGAAATATTAAATGTGG + Intergenic
1120576782 14:86191704-86191726 ATGTATATACATATTAGTTTTGG + Intergenic
1120660475 14:87243292-87243314 ATATATATATATATAAATTGAGG + Intergenic
1121772836 14:96565305-96565327 ATGAATACAAATATAGCTTGAGG - Exonic
1122757206 14:103991123-103991145 ATGTGCACAAATATTAATGAAGG - Intronic
1123683246 15:22778215-22778237 ATATATATAAATATTCATTTTGG + Intronic
1124194931 15:27616295-27616317 ATATATATATATATTATTTGAGG - Intergenic
1124957429 15:34368376-34368398 ATCTATACAAAAATAAAATGTGG - Intergenic
1126169856 15:45686144-45686166 ATATATATATATATTAAATGAGG - Intronic
1126409994 15:48363455-48363477 ATGCATACATATGTTTATTGTGG + Intergenic
1126812482 15:52421682-52421704 ATGCATAAACATTTTAATTGAGG - Intronic
1129369681 15:75083057-75083079 TTGTACACAAATATTCATAGTGG + Intronic
1129785576 15:78308054-78308076 ATGTCTTCAAATTTTAATTTTGG + Intergenic
1130752074 15:86723197-86723219 ATGCATACATATGTTTATTGTGG + Intronic
1130845228 15:87737750-87737772 ATGCACACATATATTTATTGTGG - Intergenic
1130931885 15:88435070-88435092 ATGTATAAGAATATTCATTGTGG + Intergenic
1131756005 15:95563529-95563551 AGGGAGACAAATATTAATTAAGG + Intergenic
1131775507 15:95792888-95792910 ATGTACTAAAATAATAATTGGGG - Intergenic
1131963854 15:97817053-97817075 ATATATACAAATAATTATAGGGG + Intergenic
1132440464 15:101859259-101859281 ATCTATACAAATATAATTTTAGG - Intergenic
1134789792 16:16979360-16979382 ATGTACAAAAATGTTCATTGTGG + Intergenic
1135301088 16:21327991-21328013 AAGTATAAAAGTATTAATTTGGG - Intergenic
1135813565 16:25611539-25611561 AATTATAAAAATATTAATTTGGG + Intergenic
1136192644 16:28626271-28626293 ATGTACACATATGTTTATTGCGG - Intergenic
1136361492 16:29782857-29782879 AAGTATAAAAGTATTAATTTTGG - Exonic
1136603234 16:31311828-31311850 ATGCATACAAGTGTTTATTGCGG + Intronic
1137347515 16:47678217-47678239 ATGCATACATATGTTTATTGTGG - Intronic
1137360227 16:47807744-47807766 ATGCATACATATGTTTATTGTGG - Intergenic
1137720501 16:50624973-50624995 ATGTATACAAAGAGAAACTGAGG + Intronic
1138038056 16:53628264-53628286 AAGAGTACAAATTTTAATTGGGG + Intronic
1138048577 16:53752049-53752071 ATGTATAAGAATATTCATTGTGG + Intronic
1138544605 16:57708551-57708573 ATGTATACAAATATTCATGGCGG - Intronic
1139060369 16:63243266-63243288 ATGTATAGAATGATTAATAGTGG + Intergenic
1139149469 16:64363592-64363614 ATGTATCCAAAAAGTCATTGCGG + Intergenic
1139395577 16:66636031-66636053 ATTTATAAAAATATTGATTCTGG - Intronic
1139452048 16:67036232-67036254 ATTTATACAATTTTAAATTGTGG + Intronic
1139702730 16:68718892-68718914 ATGGATACAACAATTAATTGTGG + Intronic
1140937044 16:79682369-79682391 GTGTATATATATATTTATTGAGG + Intergenic
1140996925 16:80269535-80269557 ATAGATACAAATTTTAATTTTGG - Intergenic
1142592976 17:1015015-1015037 ATGTATACAGATTTTTTTTGTGG - Intronic
1145789739 17:27618856-27618878 ATGTATACAAAAATTTTTTTTGG - Intronic
1146112086 17:30099097-30099119 TTGTAAACAAATGTTAATGGAGG - Intronic
1147512781 17:41086072-41086094 CTTTATACAAAAATTAATTCAGG - Intronic
1148003741 17:44407956-44407978 TTTTATAAAAATCTTAATTGTGG - Intronic
1149053187 17:52331277-52331299 TTGTAAACAAATATTAATTCAGG - Intergenic
1149071050 17:52543766-52543788 ATTTATGCAAATATTAAATAAGG + Intergenic
1149194801 17:54106846-54106868 TTATATACAAAAATTAATTCAGG + Intergenic
1149462849 17:56847061-56847083 ATGTATAAAAATATTCACTGTGG - Intronic
1149574854 17:57704458-57704480 ATGTATACATAAGTTATTTGTGG + Intergenic
1149743647 17:59073178-59073200 ATGTACACACATAGTAATTGTGG - Intronic
1151072188 17:71227397-71227419 ATATATACAAATATTTACAGAGG - Intergenic
1151095992 17:71498701-71498723 TTGTATACAAGTATTTTTTGAGG - Intergenic
1151793621 17:76326946-76326968 ATGTATATAAATGTTAAATTTGG + Intronic
1153161597 18:2211213-2211235 ATGTATAAGAATATTTATTGCGG - Intergenic
1154203920 18:12320784-12320806 ATATATACAAATGTTTACTGAGG - Intronic
1154352248 18:13594025-13594047 ATATATGCAAATATTACATGAGG - Intronic
1154361756 18:13668775-13668797 AGGTATACAAATACTTACTGTGG - Intronic
1154441660 18:14394347-14394369 ATATATACAAACATTTTTTGGGG + Intergenic
1155178868 18:23325762-23325784 ATATATAGAAATATGAATTGTGG + Intronic
1155244328 18:23892976-23892998 ATGTATATAAATATTTATAAAGG + Intronic
1155385433 18:25272455-25272477 ATGTACACATATGTTTATTGTGG + Intronic
1155466879 18:26145809-26145831 CTGTAAACAAATATTCATAGAGG - Intronic
1155723425 18:29048829-29048851 ATGGATACAGATATTCATTTTGG + Intergenic
1155790335 18:29959901-29959923 ATGTACACGTATATTTATTGTGG - Intergenic
1155815684 18:30305950-30305972 ATTTAGACACATATTAATTTGGG + Intergenic
1155817209 18:30327832-30327854 ATTTATAAAAATTTAAATTGTGG + Intergenic
1156002499 18:32400867-32400889 ATGTACACATATGTTTATTGTGG + Intronic
1156084449 18:33382240-33382262 ATGTATACATATATCTATTGGGG - Intronic
1156744823 18:40377104-40377126 ATGTATAGATACATTCATTGGGG - Intergenic
1156807253 18:41200260-41200282 ATATATACATATATTCAATGTGG + Intergenic
1156887024 18:42147035-42147057 CTGTATACAAAAATTAACTCAGG + Intergenic
1157691850 18:49689687-49689709 ATGAATACAGAAATTAATAGAGG + Intergenic
1157837306 18:50917635-50917657 ATTTATATAAATATTAAAAGTGG - Intronic
1157996926 18:52569449-52569471 ATGTATACTAAAATTATTTGAGG + Intronic
1158274493 18:55752032-55752054 TTGTATACAAATTTTCATAGCGG - Intergenic
1158748563 18:60230377-60230399 ATATATATAAATATTATTGGGGG - Intergenic
1159016770 18:63107407-63107429 AAGTAAACAAACATTAATTGAGG + Intergenic
1159748439 18:72269754-72269776 ATGCACACAAATGTTTATTGTGG + Intergenic
1160249292 18:77186983-77187005 AATTATAAAAGTATTAATTGGGG + Intergenic
1160356216 18:78230001-78230023 TTGTATAAAAATATAAATTTTGG - Intergenic
1160642577 19:152432-152454 ATGCATACATATGTTTATTGTGG + Intergenic
1163919443 19:20275121-20275143 TTGTATAAAATGATTAATTGAGG + Intergenic
1163972680 19:20814116-20814138 ATGTATAACAATAATTATTGTGG + Intronic
1164025627 19:21349250-21349272 AATTATAAAAATATTAATTTTGG + Intergenic
1164074054 19:21796897-21796919 ATTTCCACAAATATTATTTGGGG + Intergenic
1164287647 19:23835186-23835208 ATTTATAAAAATATTTATTAAGG - Intergenic
1164496444 19:28768215-28768237 ATGCATACGTATATTTATTGTGG - Intergenic
1165042507 19:33079286-33079308 ATGCATGCATATATTCATTGAGG + Intergenic
1165261208 19:34620221-34620243 ATGTACACATATGTTTATTGTGG + Intronic
1165864464 19:38927871-38927893 AAAAATACAAAAATTAATTGGGG + Intronic
1166201785 19:41242479-41242501 ATATATACAAAAATTAGCTGGGG - Intronic
1166245218 19:41520324-41520346 ATGTATACACATCTTAAATTTGG + Intergenic
1168392176 19:56018807-56018829 AAGAATACAAAAATTAAATGAGG - Intronic
925553978 2:5108114-5108136 ATGTACACGTATATTTATTGCGG - Intergenic
925618933 2:5771533-5771555 ATGTTTAGATATATTAAGTGTGG + Intergenic
925644415 2:6021238-6021260 ATGTTTATAAATAATAATTTAGG - Intergenic
926256247 2:11203068-11203090 AAGTACACAAATACTAAGTGTGG - Intronic
926613183 2:14968333-14968355 ATGTATACAAATAACAATAAGGG + Intergenic
928901520 2:36323287-36323309 AATTATAAAAATATTAATTTGGG - Intergenic
929286821 2:40144604-40144626 TAGAATACAAATATTAATTATGG - Intronic
929497195 2:42455896-42455918 ATGTATATAATTATTATTTTAGG - Intronic
929656749 2:43740479-43740501 AAGTATAAAAATATTAACAGAGG - Intronic
929725139 2:44417430-44417452 ATGAATACATAAATGAATTGTGG - Intronic
930328492 2:49951658-49951680 ATGTTTACAAATGTAAATTTAGG + Intronic
930332676 2:50006076-50006098 ATGTCTACAAATACTTACTGAGG - Intronic
930399049 2:50859894-50859916 ATGTATACAGATATCAGTTTGGG - Intronic
930440391 2:51397166-51397188 ATGCACACATATATTTATTGCGG + Intergenic
930613501 2:53569209-53569231 ATGTAGCCAAATATTAAATAAGG + Intronic
931410283 2:62023464-62023486 ATATATGCAAATATTTACTGTGG + Intronic
931800341 2:65751715-65751737 ATGTATAGAATTATTAGTTCAGG - Intergenic
932513545 2:72321250-72321272 CTGTACACAAATGTTTATTGTGG + Intronic
932868221 2:75369337-75369359 ATGCACACATATATTTATTGTGG - Intergenic
933072058 2:77871292-77871314 ATGCACACATATATTTATTGCGG - Intergenic
933313707 2:80690853-80690875 ATGCACACATATGTTAATTGAGG - Intergenic
933449790 2:82433443-82433465 ATTTATAAAAACATTAACTGTGG + Intergenic
933459917 2:82569513-82569535 AATTATACAAGTATTAATTTGGG - Intergenic
933547881 2:83738358-83738380 ATGTACACACATGTTTATTGTGG - Intergenic
933603670 2:84359510-84359532 ATGTACACATATGTTTATTGTGG + Intergenic
933653476 2:84868128-84868150 ATGCATACACATGTTTATTGTGG + Intronic
933680009 2:85091342-85091364 ATTTATAAAAATATTCATTGTGG + Intergenic
934693908 2:96384661-96384683 ATGTACACATATGTTTATTGCGG + Intergenic
934701620 2:96446136-96446158 ATGTACACATATGTTTATTGCGG + Intergenic
935015917 2:99181911-99181933 ATGTATACAATTATTAAAGGGGG - Intronic
935232852 2:101114398-101114420 AATTAAACAAATATTTATTGAGG - Intronic
935541005 2:104349168-104349190 ATGTATTCATATATACATTGTGG - Intergenic
936432386 2:112475612-112475634 GTGTATACAACTATTAGATGTGG + Intergenic
936694482 2:114929889-114929911 AATTATAAAAATATTAATTTGGG + Intronic
937602843 2:123759728-123759750 ATGTACACATATGTTTATTGTGG + Intergenic
937628980 2:124077708-124077730 ATTTATCCATATTTTAATTGAGG - Intronic
937651729 2:124326809-124326831 ATACATACAAATATTAGTTGGGG + Intronic
937654079 2:124355171-124355193 ATGTCTACAAAAAATAATTAGGG + Intronic
937690881 2:124753896-124753918 ATGTATACAAAGATAACTTTTGG - Intronic
937814385 2:126235115-126235137 ATGTGTATGAATATTATTTGTGG + Intergenic
938539966 2:132277719-132277741 ATATAAACAAGTATTAATTATGG + Intergenic
939072442 2:137559545-137559567 CAGTATACAAAAATTAATTCAGG + Intronic
939290910 2:140193750-140193772 GAGTATAAAAATATTAATGGAGG - Intergenic
939298442 2:140301444-140301466 ATTTGTACAAATTTTAATTTTGG + Intronic
939319387 2:140597364-140597386 GTATATACAAAAATCAATTGAGG + Intronic
939338904 2:140867990-140868012 ATGTATACATATATTAAAATTGG - Intronic
939372034 2:141313737-141313759 ATGTATATAAAAATAACTTGGGG + Intronic
939455718 2:142432325-142432347 ATGCACACATATATTTATTGCGG + Intergenic
939587022 2:144018434-144018456 ATGTCTTCCAATATTAATTCTGG - Intronic
939774165 2:146363470-146363492 CTGTATACAAGTATTAATGCAGG - Intergenic
939886185 2:147684470-147684492 AGGTATACAAATCTTAATGATGG + Intergenic
940069696 2:149671963-149671985 ATGTACACATATGTTTATTGTGG - Intergenic
940700778 2:157040082-157040104 GTGTATACAAAGATCAAATGAGG - Intergenic
941106234 2:161357203-161357225 AGGTTTACAAATTTTAAATGTGG - Intronic
941108082 2:161384442-161384464 ATTTATACAATTATTACTTGAGG - Intronic
941128711 2:161619509-161619531 ATGTAAACACATGTGAATTGTGG + Intronic
941511419 2:166415653-166415675 AAGTATAAAAGTATTAATTTGGG - Intronic
941603476 2:167566044-167566066 ATGCATACATATGTTTATTGCGG + Intergenic
941868586 2:170360200-170360222 ATGCATACAAATGAGAATTGTGG + Intronic
941938756 2:171010430-171010452 ATGTATACAAACATACTTTGAGG + Intronic
943007445 2:182403216-182403238 ATGCACACATATATTTATTGCGG + Intronic
943177929 2:184502173-184502195 ATGCATACATATGTTTATTGTGG - Intergenic
943362624 2:186940061-186940083 ATGAATAAAAATATTTATTGTGG - Intergenic
943432488 2:187822079-187822101 ATGTATACAAATATAAATAGTGG - Intergenic
943514963 2:188873899-188873921 ATGTATACATAGATGAAGTGGGG - Intergenic
943653022 2:190477664-190477686 ATATATACATATATTAACTCAGG + Intronic
943872945 2:193025295-193025317 AATTATACAAGTATTAATTTGGG - Intergenic
943897199 2:193379939-193379961 AGATATACAAATGTTAATGGTGG + Intergenic
943915175 2:193622643-193622665 ATGTACACATATGTTTATTGTGG - Intergenic
943916054 2:193633836-193633858 ATGTACACATATGTTTATTGTGG + Intergenic
943920767 2:193705350-193705372 ATGTACACATATGTTTATTGTGG - Intergenic
943990752 2:194688469-194688491 ATATATTCAAAAAATAATTGTGG - Intergenic
944189759 2:196990583-196990605 TTGTATTCAAGTATTATTTGGGG - Intronic
944496379 2:200311192-200311214 AAGTTAACAAATATTTATTGAGG - Intronic
945234380 2:207621220-207621242 TGGTATACACACATTAATTGAGG - Intronic
945473812 2:210258104-210258126 ATGCACACATATATTTATTGTGG + Intergenic
945829167 2:214762394-214762416 ATGCATATACCTATTAATTGAGG - Intronic
946513185 2:220382663-220382685 ATGCACACATATATTTATTGTGG - Intergenic
946932950 2:224689621-224689643 ATGTACACAGATACTCATTGTGG - Intergenic
947783795 2:232796001-232796023 ATGTGTACAAGTACTAATTTAGG + Intronic
948964018 2:241362301-241362323 GTGTTTAAAAATATTAATTTTGG + Intronic
1168856352 20:1011943-1011965 ATGAATACAAATAATAATGATGG - Intergenic
1169040289 20:2488742-2488764 ATCTATAAAAATATTTTTTGAGG + Intronic
1169098627 20:2926173-2926195 AATAATACAAATATTAAATGGGG - Intronic
1169938252 20:10908547-10908569 ATATTTATATATATTAATTGGGG - Intergenic
1170255028 20:14332181-14332203 ATTTTTACAAATAAAAATTGTGG + Intronic
1171974106 20:31583059-31583081 ATATATACAAAAATTAGTTAGGG + Intergenic
1172420046 20:34808344-34808366 ATTTATCCAAATATTTATGGGGG + Intronic
1172679800 20:36704455-36704477 ATGTATACATATACTATTTCTGG + Intronic
1174717195 20:52772096-52772118 CTGTATACAAAACTGAATTGGGG - Intergenic
1174731624 20:52923634-52923656 ATGTAAATAAATAGTAATGGGGG + Intergenic
1175060882 20:56241545-56241567 ATGCACACAAATGTTTATTGCGG + Intergenic
1175679289 20:60973872-60973894 ATAAATACATATATTAAATGTGG - Intergenic
1176454402 21:6896826-6896848 ATATATACAAACATTTTTTGGGG - Intergenic
1176832575 21:13761874-13761896 ATATATACAAACATTTTTTGGGG - Intergenic
1177154498 21:17487348-17487370 ATGTACACAAATCATAAGTGTGG - Intergenic
1177286876 21:19062985-19063007 ATGTAAACATATATTAAACGTGG + Intergenic
1177329811 21:19643487-19643509 ATGAATCAAAATGTTAATTGTGG - Intergenic
1177365542 21:20130462-20130484 ATGAATTTAAATATTAATTAGGG + Intergenic
1177543673 21:22529024-22529046 ACTTATACAAAAATTAATTCAGG - Intergenic
1177581754 21:23032349-23032371 ATGCACACAAATATTCATTGAGG - Intergenic
1177605341 21:23370602-23370624 ATGTAAATAAATAATAATTAGGG + Intergenic
1177646609 21:23906817-23906839 ATGCACACATATATTTATTGTGG - Intergenic
1177670027 21:24212921-24212943 ATGCACACATATATTTATTGTGG + Intergenic
1178197784 21:30368053-30368075 ATGCACACATATATTTATTGCGG - Intronic
1178276000 21:31237429-31237451 ATCTTTACAAAAATTAAGTGTGG - Intronic
1178616525 21:34138880-34138902 ATGCATACATATGTTTATTGCGG + Intronic
1179380350 21:40893204-40893226 AAGTACACAAATATTAGTGGAGG + Intergenic
1180290471 22:10847754-10847776 GTGTATAAAAATTATAATTGAGG + Intergenic
1180493270 22:15877175-15877197 GTGTATAAAAATTATAATTGAGG + Intergenic
1180602271 22:17029817-17029839 ATGCACACGTATATTAATTGTGG + Intergenic
1181297800 22:21855210-21855232 GTGAATTCAAACATTAATTGGGG + Intronic
1181784030 22:25213030-25213052 ATGTATAAAAATATGTATTTTGG - Intergenic
1182202428 22:28587421-28587443 CTGTATAAAAATTTAAATTGTGG - Intronic
1182513290 22:30835668-30835690 ATGTATACAGAAATCAATTCTGG - Intronic
1182741149 22:32568332-32568354 TAGTCTACAAATATTTATTGAGG + Intronic
1183874928 22:40772036-40772058 TTGTATACAAATGTTAATAATGG - Intronic
1203292885 22_KI270736v1_random:12683-12705 ATGTATACAACTATAAATCTAGG - Intergenic
949425791 3:3914481-3914503 ATGCACACATATATTTATTGCGG + Intronic
950849057 3:16044491-16044513 AGTTACACAAATATTATTTGAGG - Intergenic
950909512 3:16574373-16574395 ATGTACACAAATGTTCACTGTGG + Intergenic
951173619 3:19573369-19573391 ACTTATACAAATACTAATTATGG + Intergenic
951426726 3:22554864-22554886 ATGTACACATATGTTTATTGCGG + Intergenic
951678633 3:25271185-25271207 ATTTATACTAATAAAAATTGAGG - Intronic
952019944 3:29006389-29006411 ATGTATACAAAAATTAAAGATGG + Intergenic
952187311 3:30983946-30983968 ATTTATACAAATTTTATTTCAGG + Intergenic
952517125 3:34116527-34116549 ATGTATACGTATGTTTATTGTGG - Intergenic
952631734 3:35477818-35477840 ATGCATACATATGTTTATTGCGG - Intergenic
952640880 3:35594146-35594168 ATGTATACGTATGTTTATTGTGG + Intergenic
953082805 3:39636389-39636411 AATTTAACAAATATTAATTGAGG + Intergenic
953275898 3:41497415-41497437 ATCTATATACATAATAATTGGGG + Intronic
955019031 3:55100596-55100618 ATGTACACGAATGTTTATTGTGG + Intergenic
955030759 3:55214802-55214824 ATGTACACGAATGTTTATTGTGG + Intergenic
955050974 3:55410542-55410564 ATTTATAAAAATGTTAAGTGGGG + Intergenic
956161756 3:66362230-66362252 CTGTATACAAATGTTCATGGTGG + Intronic
956795080 3:72710789-72710811 ATGAATACATATGTTTATTGCGG - Intergenic
957109271 3:75931650-75931672 ATATATAGATATATTAATTTGGG - Intronic
957487292 3:80878939-80878961 ATGAAAACATATATTAATTATGG - Intergenic
957623134 3:82621408-82621430 AATTATAAAAATATTAATTGGGG + Intergenic
957707974 3:83814605-83814627 ATTTATTAAAATATTAATTAAGG + Intergenic
957887204 3:86302712-86302734 ATGCACACATATATTTATTGCGG + Intergenic
957974656 3:87427675-87427697 CTGAAGACAAGTATTAATTGAGG - Intergenic
958120338 3:89278708-89278730 ATATATACAAATCTTAAATCAGG - Intronic
958204852 3:90376508-90376530 ATGTACACATATGTTTATTGGGG + Intergenic
958471725 3:94529567-94529589 AAATATACAAATTTTAATGGTGG - Intergenic
958497143 3:94859988-94860010 AATTATAAAAATATTAATTTTGG - Intergenic
958595091 3:96212292-96212314 ATGAATATAAATATTAATGATGG + Intergenic
958950410 3:100409893-100409915 ATATATACAAATATATATTTAGG - Intronic
958953987 3:100447142-100447164 ATGTACACATATATTTATTATGG + Intronic
958963200 3:100530165-100530187 ACTTATACAAATATTATCTGGGG - Intronic
959024301 3:101222867-101222889 ATATATAGAAAAAATAATTGTGG - Exonic
959142172 3:102499684-102499706 AATTGGACAAATATTAATTGAGG + Intergenic
959465221 3:106678128-106678150 ATAAATACTAATAGTAATTGAGG - Intergenic
959835302 3:110911886-110911908 ATGTACACATATGTTTATTGTGG - Intergenic
959870034 3:111316072-111316094 ATGAATACAAATAATCATTAGGG + Intronic
959907558 3:111727266-111727288 GTGTATACAAAGATTAAATAAGG + Intronic
960116313 3:113896506-113896528 ATGTGTATAAATATCAGTTGTGG + Intronic
960606567 3:119512069-119512091 ATGTATAAAAAGATTATTTGTGG + Intronic
961020682 3:123503681-123503703 ATGGAAACTAATATAAATTGGGG - Intronic
961337934 3:126195655-126195677 ATGCACACATATATTTATTGTGG + Intronic
961991262 3:131194365-131194387 ATATATAGAAATATAAATTTGGG - Intronic
962001003 3:131297109-131297131 ATGTATACGTATGTTTATTGTGG - Intronic
962549109 3:136470677-136470699 ATGCATACATATGTTTATTGCGG + Intronic
962651496 3:137498422-137498444 ATTTATAAAAGTATTAATTTGGG - Intergenic
962669684 3:137692460-137692482 ATTTAGCTAAATATTAATTGAGG - Intergenic
963218437 3:142777829-142777851 ATATATACAAATTATAATTTGGG - Intronic
963373490 3:144433491-144433513 ATGTATAAATATATCAGTTGTGG - Intergenic
963420208 3:145052479-145052501 ATTTATACAAATAGAAATTCAGG + Intergenic
963611127 3:147470431-147470453 ATGTTTAAAAATCTTAAGTGAGG - Intronic
963879979 3:150518145-150518167 TTGTATACAAATGTCCATTGCGG + Intergenic
963983926 3:151570182-151570204 ATGCACACAAATGTTTATTGCGG - Intergenic
964001054 3:151772322-151772344 ATTTATAAAAATATTTATTTTGG + Intergenic
964104800 3:153027542-153027564 AATTCTACAATTATTAATTGTGG + Intergenic
964427189 3:156566450-156566472 ATATATAAAAATATTAATAGTGG - Intergenic
964653272 3:159035898-159035920 ATGTATTCAAGTATTTATTCTGG + Intronic
964686558 3:159402474-159402496 ATGCACACATATATTTATTGTGG + Intronic
964783272 3:160364545-160364567 ATGCATACATATATTTATGGTGG + Intronic
964786127 3:160398735-160398757 ATGTATACAAACACTACTTAGGG + Intronic
965257796 3:166438709-166438731 ATGTCTACAAATATTTATCTAGG - Intergenic
965299500 3:166991965-166991987 ATATATACACAAATTAATTCTGG + Intergenic
965321488 3:167257150-167257172 TTGTATAAAAATTTTATTTGTGG + Intronic
965424840 3:168509224-168509246 ATGCTTCCAAATATTAATTTGGG + Intergenic
965498587 3:169429704-169429726 AGGTATGCAACTATTAAGTGTGG - Intronic
965877648 3:173347168-173347190 ATGGATATAAATATTAATTTGGG - Intergenic
966013288 3:175109340-175109362 ATGTTAACAAATATTTATTGAGG + Intronic
966107417 3:176353378-176353400 ATGTTTAAAAATATTTATTTAGG - Intergenic
966126659 3:176585245-176585267 ATATATACAGATAGTAATTTTGG - Intergenic
966305358 3:178527008-178527030 ATGTCTACATATATGAATGGCGG - Intronic
966425229 3:179773813-179773835 ATGTATAGATTTATAAATTGGGG - Intronic
966687792 3:182714910-182714932 ATTTTTAAAAATTTTAATTGTGG - Intergenic
966991732 3:185238945-185238967 CCATATACAAAAATTAATTGAGG - Intronic
967217332 3:187221459-187221481 ATGTATACAAAAATGAAGTTTGG + Intronic
967315228 3:188146094-188146116 ATATATACACAGTTTAATTGAGG - Intergenic
967653070 3:192010203-192010225 CTATATACAAATTTAAATTGTGG - Intergenic
967713307 3:192734472-192734494 ATGTATACAAATTTGCATAGAGG - Intronic
968932907 4:3592157-3592179 TTGTTTAAAAATATAAATTGTGG - Intergenic
970079032 4:12259156-12259178 ATGCATACATATGTTCATTGTGG + Intergenic
970282817 4:14477031-14477053 ATGTATTAAATTATTCATTGGGG - Intergenic
971326239 4:25646194-25646216 ATGTATGAAAATATTCATTACGG - Intergenic
971480163 4:27107775-27107797 ATGCACACATATATTTATTGCGG + Intergenic
971657768 4:29371286-29371308 AAGTATAAAAGTATTAATTCAGG - Intergenic
971706403 4:30048931-30048953 ATGCACACAAATGTTTATTGTGG + Intergenic
971894265 4:32571118-32571140 ATATATTGGAATATTAATTGGGG + Intergenic
972167711 4:36307658-36307680 ATGTATACCATAATTAAATGGGG - Intronic
972214817 4:36884523-36884545 ATGTAAACAAATATACTTTGGGG + Intergenic
973128000 4:46612457-46612479 GTGTATAAAAATATTAAATTTGG + Intergenic
973154229 4:46929603-46929625 ATGTATATAGTTATTTATTGTGG - Intronic
973275737 4:48306078-48306100 ATATATACAAACATTATTTTGGG + Intergenic
973648684 4:52975716-52975738 ATGCACACGAATATTTATTGTGG + Intronic
974071640 4:57129349-57129371 ATGTATACATAATTTTATTGAGG + Intergenic
974116808 4:57589072-57589094 ATGGAAACAAATATTAATAGAGG + Intergenic
974116821 4:57589284-57589306 AGGTTTTCACATATTAATTGCGG - Intergenic
974382403 4:61158338-61158360 GTGCAAACACATATTAATTGTGG + Intergenic
974527978 4:63069658-63069680 ATTTATAAAAATGTTATTTGGGG - Intergenic
974536239 4:63179282-63179304 ATGTACACATATGTTTATTGTGG - Intergenic
974611018 4:64215520-64215542 ATATATATAAATAATAAATGAGG + Intergenic
974700947 4:65445738-65445760 TTGTACAAAAATATTAATTTTGG + Intronic
974788606 4:66655881-66655903 ATATATACAAATATTCATTCTGG + Intergenic
974866914 4:67592347-67592369 TTGTATAAAAATATTAGTTTAGG + Intronic
975002937 4:69247625-69247647 ACATTTACAAATATTATTTGAGG - Intergenic
975011219 4:69354983-69355005 ACATATACAAATATTATTTGAGG - Intronic
975160549 4:71120185-71120207 ATTTATACAAATATAAATTGAGG + Intergenic
975706814 4:77120072-77120094 GTGTTTAAAAATATGAATTGAGG - Intergenic
975791905 4:77962026-77962048 ATGCACACATATATTTATTGCGG - Intergenic
976664382 4:87574442-87574464 ATGCACACATATATTTATTGTGG + Intergenic
977064354 4:92294964-92294986 ATGCACACAAATGTTTATTGTGG - Intergenic
977172285 4:93778278-93778300 TTGTAAACAGATATTAATAGAGG - Intergenic
977454380 4:97239546-97239568 ATGTGTACAGATTGTAATTGTGG + Intronic
977843470 4:101739360-101739382 ATGCATACGTATATTTATTGTGG - Intronic
978156402 4:105494060-105494082 AGGTATACAAATATGAAGAGAGG - Intergenic
978256971 4:106703811-106703833 GTGTAAACAAATTTTAATTAAGG + Intergenic
978611883 4:110550709-110550731 ATGTATAGATATATAGATTGTGG + Intronic
978738656 4:112113036-112113058 ATGTACTTAAATATGAATTGGGG - Intergenic
978787613 4:112627335-112627357 ATCTAGACAAAAATTAATGGAGG - Intronic
979016957 4:115447084-115447106 ATGCATACATATGTTTATTGTGG - Intergenic
979110728 4:116752347-116752369 ATGTATACACATTTAAATTTAGG + Intergenic
979142752 4:117199235-117199257 ATGTATAGAAAAAATAATTGAGG + Intergenic
979506193 4:121500580-121500602 ATGTTTAAAGATATGAATTGAGG + Intergenic
979817626 4:125129507-125129529 ATGCACACATATATTTATTGCGG - Intergenic
979883790 4:125997332-125997354 ATGTCCACAAAAATTAATTTAGG + Intergenic
980445505 4:132901566-132901588 ATGCATATTAATATTAATAGAGG - Intergenic
980684668 4:136211391-136211413 ATGCACACATATATTTATTGCGG - Intergenic
980805444 4:137807288-137807310 ATATATAAAAATATTAATGTCGG + Intergenic
981223031 4:142258897-142258919 ATGCACACATATATTTATTGTGG + Intronic
981519073 4:145642229-145642251 ATGTTGAAATATATTAATTGTGG + Intronic
981973930 4:150700223-150700245 ATATATACAAATATAAATTGTGG - Intronic
982222312 4:153135453-153135475 TGGTGCACAAATATTAATTGTGG + Intergenic
982853302 4:160346791-160346813 ATGTACACACATATTCATTGTGG + Intergenic
982871674 4:160587072-160587094 ATATATACATATATTTTTTGGGG + Intergenic
982910111 4:161129954-161129976 TGCTATACAAATATCAATTGTGG - Intergenic
983070341 4:163260322-163260344 ATGCATACAAATATTATTCTAGG + Intergenic
983137975 4:164108533-164108555 ATTTATATAAAAATTAAATGTGG - Intronic
983263339 4:165480895-165480917 ATATATACAAATGTTAGTAGTGG + Intronic
983418683 4:167490349-167490371 ATGCACACATATATTTATTGTGG + Intergenic
983863578 4:172736715-172736737 AATTATAAAAATATTAATTTGGG + Intronic
984088519 4:175341761-175341783 AGGTAGACAAAGATTAATTGTGG - Intergenic
984688721 4:182701056-182701078 ACATATATAAATATTAATTTTGG - Intronic
985001748 4:185491962-185491984 ATAACTAAAAATATTAATTGTGG - Intergenic
985354041 4:189098054-189098076 ATATAGAAAAATATTAATAGAGG + Intergenic
986582192 5:9277508-9277530 ATGCACACATATATTTATTGTGG + Intronic
987894080 5:23921914-23921936 ATGTATATAAATATTTATAGTGG - Intergenic
988016519 5:25566748-25566770 ATCTTTACTGATATTAATTGGGG + Intergenic
988391477 5:30639055-30639077 ATGTCAACAAATATATATTGAGG - Intergenic
988701364 5:33678315-33678337 ATTTGAACAAATATTTATTGAGG + Intronic
988830509 5:34982504-34982526 AATTATAAAAATATTAATTTGGG + Intergenic
988937608 5:36103560-36103582 ATGAATACAGTTATTATTTGAGG + Exonic
989073614 5:37538572-37538594 ATGTATACTAAGTTAAATTGTGG + Intronic
990177646 5:53125921-53125943 ATGTGTCCAAACATAAATTGAGG - Intergenic
990263786 5:54054338-54054360 ATGTATAAGAAAATTTATTGTGG + Intronic
990303058 5:54468200-54468222 ATGTACAAAAATATTCATAGTGG - Intergenic
990470235 5:56108586-56108608 ATGTATACAAATATGAGTGAGGG + Intronic
990775022 5:59296726-59296748 ATGTTGCCAAATATTAATTCAGG + Intronic
991623950 5:68578194-68578216 ATTTATACTAATATTAAGAGTGG - Intergenic
992012658 5:72544670-72544692 ATGTACACATATGTTTATTGCGG - Intergenic
992035287 5:72767842-72767864 GTCTGTACAAATATTAATTCTGG + Intergenic
992273176 5:75087047-75087069 ATGTACAGAAATATTTATTATGG - Intronic
992376410 5:76192188-76192210 AGGTATACACAGATTACTTGGGG + Intronic
993303023 5:86238012-86238034 ATGCATACATATGTTTATTGTGG + Intergenic
993435077 5:87883026-87883048 ATGCATACATATGTTTATTGTGG - Intergenic
993483884 5:88458197-88458219 ATGTACACATATGTTTATTGCGG + Intergenic
993507674 5:88731190-88731212 ATGTATGGAAAGATGAATTGAGG + Intronic
994001041 5:94779420-94779442 AGGTAAACCAATATTAATTTGGG + Intronic
994201573 5:96982819-96982841 AAGTACACAAATTTTAAGTGTGG + Intronic
994754125 5:103773965-103773987 ATTTATCTAAATGTTAATTGTGG - Intergenic
994863312 5:105228217-105228239 GTGTACACAAATATAAATTGAGG - Intergenic
994889093 5:105606092-105606114 ATGTACACATATGTTTATTGTGG + Intergenic
995024682 5:107406238-107406260 ATGTATACAAATATTAATTGTGG + Intronic
995098953 5:108274713-108274735 AAGTATAAAAGTATTAATTTGGG + Intronic
995107584 5:108392266-108392288 CTGTATACAAGTATTTATGGAGG + Intergenic
995467027 5:112461190-112461212 ATGCATACATATGTTTATTGTGG - Intergenic
995729457 5:115222668-115222690 ATGTACACATATGTTTATTGTGG + Intronic
996164053 5:120203083-120203105 TGGTAAACAAATATTTATTGAGG - Intergenic
996524196 5:124460482-124460504 GTGTATACAGATTTTAATAGAGG + Intergenic
997810215 5:136960361-136960383 ATTTAAACCAATATTAATTATGG - Intergenic
997849459 5:137317883-137317905 AAGAATAAAAATATGAATTGAGG - Intronic
998283944 5:140840163-140840185 ATGTATACAAATTTTAAATATGG + Intronic
998484537 5:142490304-142490326 CTGGATCCAAATATTAATTATGG - Intergenic
999046956 5:148479925-148479947 ATGTATATGATTGTTAATTGTGG - Intronic
999262948 5:150248783-150248805 ATGCACACATATATTTATTGCGG - Intronic
999566780 5:152872502-152872524 CTTTAAACAAATATTAATTAGGG - Intergenic
999576082 5:152978931-152978953 ATGACTTCAAATGTTAATTGTGG - Intergenic
999669103 5:153943147-153943169 ATGCATACATATGTTTATTGCGG + Intergenic
999711162 5:154319816-154319838 ATGTAGACAAGTCTTAAGTGGGG + Intronic
1000880287 5:166689593-166689615 ATCTATACACAAATTTATTGAGG - Intergenic
1000919592 5:167122377-167122399 ATATATGCAAATATCAAATGGGG - Intergenic
1000941767 5:167370579-167370601 ATCTATAAAAATATTGATTCTGG + Intronic
1001290600 5:170456002-170456024 ATGCATACATATATTTATTGAGG + Intronic
1001359536 5:171067318-171067340 ATGTATACAGATGTAATTTGTGG - Intronic
1001827988 5:174761663-174761685 ATGCATACATATGTTTATTGCGG - Intergenic
1001973906 5:175980912-175980934 ATCTATAAAAATAGTCATTGAGG - Intronic
1002356734 5:178635900-178635922 CTGTGTATAAATATTTATTGGGG - Intergenic
1002750242 6:102072-102094 ATGCATACATATGTTTATTGTGG + Intergenic
1004339085 6:14791918-14791940 ATGTAATCAAACATTTATTGGGG + Intergenic
1005206067 6:23406118-23406140 ATGTATGCATATATAAAATGGGG + Intergenic
1005441231 6:25871182-25871204 ATGTACACGAATGTTTATTGTGG + Intronic
1005892481 6:30151379-30151401 ATATATACAAATATTTATTATGG + Intergenic
1005941163 6:30561290-30561312 ATGTATAAAAATGTTTATAGTGG + Intronic
1006870760 6:37249189-37249211 ATGTAGACAAATATTTTTGGGGG + Intronic
1008460791 6:51767764-51767786 ATGCACACATATGTTAATTGCGG - Intronic
1009062022 6:58408435-58408457 ATGCACACATATATTTATTGTGG - Intergenic
1009447199 6:63756758-63756780 AATTATAAAAATATTAATTTGGG - Intronic
1009939736 6:70277053-70277075 ATGTATACAACTATTATCTGTGG - Intronic
1010168532 6:72945748-72945770 ATGTATACATATATCAGGTGGGG - Intronic
1010672269 6:78700001-78700023 ATGTACACATATGTTTATTGTGG + Intergenic
1011220088 6:85045812-85045834 ATGCACACATATATTTATTGTGG + Intergenic
1011253836 6:85401499-85401521 AGGTTTAAAAATATAAATTGTGG + Intergenic
1011339845 6:86302015-86302037 ATGTATTCAAATAGGAAATGAGG - Intergenic
1011819471 6:91234657-91234679 AAGTATACAAAGATTAAATAAGG + Intergenic
1011847086 6:91579195-91579217 ACGTATTCAAAGATTTATTGTGG + Intergenic
1011885111 6:92083975-92083997 ATGCATACGTATGTTAATTGTGG + Intergenic
1011908345 6:92402471-92402493 ATGTACACATATGTTTATTGTGG - Intergenic
1012487124 6:99734682-99734704 ATGTACACAAATGTTTATTGTGG - Intergenic
1012499914 6:99876932-99876954 ATTTATACTAGTACTAATTGTGG - Intergenic
1012783541 6:103593273-103593295 ATATATAAAGATATAAATTGAGG - Intergenic
1013444440 6:110208288-110208310 ATGTCTACCTATATTAATTCAGG - Intronic
1013451326 6:110284371-110284393 ATTTTTAAAAATTTTAATTGAGG - Intronic
1014251350 6:119118546-119118568 AATTATAAAAATATTAATTTGGG - Intronic
1014601851 6:123422688-123422710 ATTTATACAAGTAGTAATTTAGG + Intronic
1014710028 6:124795878-124795900 ATGTTTCAAAATATGAATTGGGG + Intronic
1014863578 6:126500653-126500675 ATATATAGAAATATGAATGGAGG - Intergenic
1015179986 6:130351057-130351079 CCTTATACAAAAATTAATTGGGG + Intronic
1015731633 6:136354059-136354081 ATTTTTACAAATATAAATTTAGG - Intronic
1015864474 6:137713829-137713851 AATTCTACAAATAATAATTGAGG + Intergenic
1016442441 6:144097658-144097680 ATGTATAAGAATATTTATTTCGG - Intergenic
1016538541 6:145136824-145136846 AAATAGACAAATAATAATTGGGG - Intergenic
1017363117 6:153599761-153599783 ATGTATAGAAATATTACTTTTGG + Intergenic
1018175291 6:161173091-161173113 ATGTACACATATGTTTATTGTGG - Intronic
1019067988 6:169318556-169318578 ATGTACACAAATTATGATTGAGG + Intergenic
1019238547 6:170644368-170644390 ATGCATACATATGTTTATTGTGG - Intergenic
1019639040 7:2093083-2093105 ATATATACAAAAATTAGCTGGGG + Intronic
1020027305 7:4908108-4908130 AGTTATAAAAATATTATTTGAGG - Intronic
1020755577 7:12198340-12198362 ATGTAAGAAAATATTAATTGGGG + Intergenic
1020814672 7:12890692-12890714 TTTTTTACAAATATTGATTGAGG - Intergenic
1020846460 7:13290381-13290403 CATAATACAAATATTAATTGAGG + Intergenic
1021223928 7:18006171-18006193 ATGCACACATATATTTATTGCGG - Intergenic
1021321577 7:19219142-19219164 ATGCACACATATATTTATTGCGG + Intergenic
1021343997 7:19500249-19500271 ATGTATACATATATTGATAACGG + Intergenic
1021836258 7:24678777-24678799 TTGGATACAAATTTTATTTGGGG + Intronic
1022130592 7:27401200-27401222 ATGCACACATATATTTATTGCGG - Intergenic
1022214853 7:28248767-28248789 TTTTATACAAATATTATATGGGG - Intergenic
1022313236 7:29217603-29217625 ATGAATACAAATATTTAGTTGGG + Intronic
1022317106 7:29255512-29255534 ATGTATATATATATTAGTTGGGG + Intronic
1022323681 7:29310407-29310429 ATGTATACAAATATAAACAATGG + Intronic
1022376608 7:29818292-29818314 AAATATACAAAAATTAACTGGGG + Intronic
1023301144 7:38773037-38773059 CTGTATATAAATTTTATTTGTGG + Intronic
1023577493 7:41644581-41644603 ATATAAACAAATATTCTTTGGGG + Intergenic
1023853595 7:44165734-44165756 ATGTATAAAAACATAATTTGTGG + Intronic
1024255140 7:47535180-47535202 TGGTCAACAAATATTAATTGAGG - Intronic
1025791815 7:64695099-64695121 ATGTATATATATATTTATTTGGG - Intronic
1026641748 7:72132563-72132585 ATGCAAACATATATTTATTGTGG - Intronic
1027150800 7:75732242-75732264 ATAGAAACAAATATTTATTGAGG - Intronic
1027307287 7:76913006-76913028 ATGTTTACAAAAATTACATGAGG - Intergenic
1027881974 7:83851206-83851228 ATGTTAACAAAGAGTAATTGAGG + Intergenic
1028219426 7:88178857-88178879 ACATATACAAATATTATTTCAGG - Intronic
1028435180 7:90794892-90794914 AACTATACAAGTATTAATTTGGG + Intronic
1028617477 7:92785075-92785097 AGGTAAACAAATATTCACTGCGG + Intronic
1028915922 7:96259046-96259068 CTGTATACAAAAATTAACTCAGG + Intronic
1029006023 7:97210506-97210528 ATGTACACATATGTTTATTGTGG - Intergenic
1029236935 7:99128169-99128191 ATGTATTTAAGTATTATTTGAGG - Intronic
1029798362 7:102920014-102920036 ATGAACACACATATTATTTGTGG - Intronic
1030056799 7:105590373-105590395 ATGTATATGAATATTCATAGTGG - Intronic
1030878828 7:114850593-114850615 TGGTATTCATATATTAATTGTGG - Intergenic
1030942902 7:115677679-115677701 ATGTATACATATATGTAATGGGG + Intergenic
1031680903 7:124673454-124673476 ATGTATACAGATCTTAATGATGG + Intergenic
1031730725 7:125297636-125297658 ATGTATACAAAATTTAATAATGG - Intergenic
1032456472 7:132076769-132076791 ATGCATGCAAATATTCATTTTGG + Intergenic
1032713504 7:134483900-134483922 ATATTTACACATATTTATTGAGG - Intergenic
1033309113 7:140247028-140247050 ATGTAGTAAAATGTTAATTGTGG + Intergenic
1035021263 7:155802343-155802365 GTGTATAAAAATATAATTTGTGG + Exonic
1035444531 7:158931214-158931236 AAATGTACAAATATTATTTGTGG + Intronic
1035509221 8:162239-162261 ATGCATACATATGTTTATTGTGG + Intergenic
1035755099 8:2024933-2024955 ACGTATAAAAATATAATTTGAGG - Intergenic
1035862431 8:3044337-3044359 ACGTATACACATCTTAAATGTGG - Intronic
1036102504 8:5802395-5802417 ATTTATGAAAGTATTAATTGAGG - Intergenic
1036938111 8:13024815-13024837 TTGTATACAAATATTTAATTTGG + Exonic
1037088723 8:14886213-14886235 ATTTCAACAAATATTTATTGAGG + Intronic
1037296533 8:17407754-17407776 ATGTACCCAAATATTAAAAGTGG + Intronic
1037503448 8:19507078-19507100 AAATATACAAATAATAAATGTGG + Intronic
1038507626 8:28099084-28099106 TTGTCAACAAATATTAACTGAGG - Intronic
1039158247 8:34587498-34587520 ATGCACACATATATTTATTGTGG - Intergenic
1039233033 8:35470133-35470155 ATAAATACAACTAGTAATTGAGG + Intronic
1039295941 8:36154933-36154955 AAAAATACAAAAATTAATTGAGG - Intergenic
1039577532 8:38635687-38635709 ATATATACAAAAATTAACTCAGG - Intergenic
1040352144 8:46580395-46580417 AATTATAAAAGTATTAATTGAGG - Intergenic
1040353173 8:46588935-46588957 AATTATAAAAGTATTAATTGGGG - Intergenic
1041051366 8:53938077-53938099 ATGTACACATATGTTTATTGAGG + Intronic
1041074452 8:54156805-54156827 ATTTAAAAAAATTTTAATTGTGG + Intergenic
1041077507 8:54182568-54182590 ATTTATAAAAAGATTATTTGAGG - Intergenic
1041418067 8:57635739-57635761 AATTATACAAATATTGATTGAGG + Intergenic
1041478068 8:58287408-58287430 ATGCATACAGATGTTTATTGCGG - Intergenic
1042173140 8:66011908-66011930 ATGCATACATATGTTCATTGTGG + Intergenic
1042579500 8:70261145-70261167 ATGTACACATATGTTTATTGCGG + Intronic
1042718218 8:71798758-71798780 ATGTATTCAAATATTGAGGGGGG - Intergenic
1043112476 8:76203687-76203709 ATATATTAAAATATTAGTTGAGG - Intergenic
1043307885 8:78819680-78819702 AAGAAAACAAATATTTATTGAGG - Intergenic
1043343642 8:79272899-79272921 ATGCATACATATGTTTATTGCGG - Intergenic
1043387455 8:79762510-79762532 GTGTATAGAAAAATTAATTCAGG - Intergenic
1043557005 8:81442184-81442206 AAATATACAAATATGAAATGAGG - Exonic
1043658528 8:82704960-82704982 ATGATTATAAATATTAATGGAGG + Intergenic
1043671525 8:82891215-82891237 TTATATACAACTAGTAATTGGGG + Intergenic
1044110240 8:88264095-88264117 GTGTATACATATATTACTTTAGG + Intronic
1044470125 8:92557273-92557295 ATGAACACATATATTTATTGTGG - Intergenic
1044647901 8:94464034-94464056 ATGAATAGATATATAAATTGTGG + Intronic
1044812315 8:96076090-96076112 ATGCACACATATATTTATTGCGG + Intergenic
1045434128 8:102142831-102142853 GTGTATATTATTATTAATTGAGG - Intergenic
1045609071 8:103813850-103813872 ATGCACACATATATTTATTGCGG - Intronic
1045749628 8:105467843-105467865 ATGCATACAGATTTTAATTATGG - Intronic
1045801561 8:106107663-106107685 ATAAATAAAAATAATAATTGTGG + Intergenic
1046153426 8:110257390-110257412 AATTATAAAAATATTAATTTGGG + Intergenic
1046250877 8:111629404-111629426 ATTTATGAAAATATTAATTTGGG - Intergenic
1046287923 8:112119859-112119881 ATGCATACATATGTTCATTGTGG + Intergenic
1046292459 8:112180756-112180778 ATGTACACATATGTTTATTGTGG - Intergenic
1046331925 8:112728389-112728411 ATGTATGTAAATATCAATAGAGG + Intronic
1046367292 8:113251911-113251933 GTGTATACATAAATTAATTTGGG + Intronic
1046772751 8:118132885-118132907 AGGGAGACAAATATTTATTGTGG + Intergenic
1047106785 8:121740313-121740335 ATGTAAACTACTATTAATTGAGG - Intergenic
1047697913 8:127421214-127421236 GTGTATACAATTATTTAATGTGG + Intergenic
1047915167 8:129575249-129575271 AGGTATAAAAATATTAATAAAGG - Intergenic
1048513546 8:135083520-135083542 ATGTATATAAATTCTAATTTTGG + Intergenic
1048629788 8:136229760-136229782 ATATTTACAAATATTTAATGAGG - Intergenic
1049927440 9:423060-423082 ATTTACCAAAATATTAATTGCGG + Intronic
1050265593 9:3886195-3886217 ATTCATACAAATATAAACTGTGG + Intronic
1050475743 9:6039201-6039223 ATGTACAAAAATAAGAATTGAGG - Intergenic
1050564444 9:6867403-6867425 ATTTATTCAAATATCAATTGTGG - Intronic
1050678186 9:8079909-8079931 ATGCATACATATGTTTATTGTGG - Intergenic
1050970491 9:11865817-11865839 AAGTGTAAATATATTAATTGGGG + Intergenic
1051493489 9:17693158-17693180 ATGTATACTAATATTGATAGTGG + Intronic
1051584003 9:18707466-18707488 ATGTAAACAGATATTACTTTGGG - Intronic
1051673368 9:19534806-19534828 ATGTACACATATGTTTATTGTGG - Intronic
1051844082 9:21431948-21431970 ATCTTTACAAATATTAATTCAGG - Intronic
1051936802 9:22452181-22452203 ATGTTTACAAATGATAATTTAGG - Exonic
1052042329 9:23752993-23753015 ATGTAATCAAATATTTTTTGAGG - Intronic
1052457143 9:28714156-28714178 ATATATATATATATTATTTGAGG - Intergenic
1052572139 9:30240436-30240458 ATGTAGACAAATATTTATAATGG - Intergenic
1052646030 9:31234226-31234248 ATGTATACAAAAATTAGTAAAGG - Intergenic
1052651288 9:31305204-31305226 ATAAAAATAAATATTAATTGTGG - Intergenic
1053020112 9:34688803-34688825 CTCTAAACAAATATTTATTGAGG + Intergenic
1053389227 9:37722067-37722089 GTGTTTACAAATCTTAATTTTGG - Intronic
1053563164 9:39217388-39217410 ATATATATATATATTCATTGTGG + Intronic
1053828950 9:42055301-42055323 ATATATACATATATTCATTGTGG + Intronic
1054133983 9:61401691-61401713 ATATATATATATATTCATTGTGG - Intergenic
1054175448 9:61871758-61871780 ATGCACACAAATGTTTATTGCGG + Intergenic
1054457224 9:65439817-65439839 TTGTTTAAAAATATAAATTGTGG + Intergenic
1054601609 9:67132134-67132156 ATATATACATATATTCATTGTGG - Intergenic
1054890500 9:70246010-70246032 ATGCATACATATGTTTATTGTGG + Intergenic
1055155097 9:73053324-73053346 ATTTATCCAAAGATTAATTTTGG - Intronic
1055339532 9:75266173-75266195 ATTTATACAAATATTAGTAAAGG + Intergenic
1055826137 9:80327191-80327213 CTGCATACAAATATTTATAGTGG + Intergenic
1055847157 9:80579564-80579586 ATGCATACATATGTTTATTGCGG - Intergenic
1056095960 9:83253808-83253830 ATGCATACATATGTTTATTGTGG + Intronic
1056181400 9:84086457-84086479 ATGCATGCAAATGTTCATTGCGG - Intergenic
1056244807 9:84683638-84683660 ATGCACACATATATTTATTGCGG - Intronic
1056499466 9:87193904-87193926 AAGTTTTCAAATATTATTTGTGG - Intergenic
1058005358 9:99907727-99907749 ATGTAAAAAATTATTAATGGAGG - Intronic
1058105212 9:100962683-100962705 ATGCACACATATATTTATTGTGG - Intergenic
1058570399 9:106336021-106336043 ATGGATACATACATTTATTGTGG - Intergenic
1058882958 9:109301337-109301359 AAGTATAAAAAAATTAATGGTGG - Intronic
1058922563 9:109631317-109631339 AATTATAAAAATATTAATTTGGG - Intergenic
1059997910 9:119931559-119931581 ATGTACACACATGTTTATTGCGG + Intergenic
1060377392 9:123129054-123129076 ATGTAGATAAAAATTACTTGGGG + Intronic
1060450183 9:123730799-123730821 ATGCACACATATATTTATTGCGG + Intronic
1062505571 9:136873736-136873758 ATCTATACAAATATAACTTTAGG - Intronic
1062758749 9:138324660-138324682 ATGCATACATATGTTTATTGTGG - Intergenic
1203359290 Un_KI270442v1:197998-198020 ATGCATACATATGTTTATTGTGG + Intergenic
1186085541 X:5986234-5986256 AAGTATAAAAATATAAATTGCGG + Intronic
1186183929 X:7001056-7001078 ATGTATCTAAATATTCTTTGAGG - Intergenic
1186318813 X:8401365-8401387 ATGCACACAAATGTTTATTGTGG + Intergenic
1186845532 X:13527066-13527088 ATGCACACATATATTTATTGTGG - Intergenic
1187930557 X:24289900-24289922 ATTTTTGCAAATATTATTTGTGG + Intergenic
1188026111 X:25210828-25210850 ATATATACAAATATAAAGTTGGG - Intergenic
1188202656 X:27310049-27310071 ATGCATACATATGTTTATTGCGG - Intergenic
1189073745 X:37893262-37893284 ATATATACATATATAGATTGTGG - Intronic
1189603969 X:42656387-42656409 ATGCATACATATGTTTATTGTGG + Intergenic
1190394214 X:49963423-49963445 ATGTACACACATATGGATTGGGG - Intronic
1191658348 X:63624075-63624097 ATGTACACATATGTTTATTGCGG + Intergenic
1191859004 X:65650576-65650598 ATTTAACCTAATATTAATTGAGG + Intronic
1192192689 X:69001927-69001949 ATGAAGACAATTATTAATTCTGG + Intergenic
1192471692 X:71404713-71404735 ATGGATACAAATATGAAATAAGG - Intronic
1192788677 X:74358309-74358331 ATGCACACATATATTTATTGTGG - Intergenic
1192826425 X:74701400-74701422 ATGCATACATATGTTTATTGTGG + Intergenic
1193061982 X:77216383-77216405 ATGTTTTCAAATATAAATTGTGG + Intergenic
1193728819 X:85077555-85077577 ATGTACACATATGTTTATTGTGG - Intronic
1193908797 X:87277331-87277353 ATGCATACATATGTTTATTGTGG - Intergenic
1194395827 X:93384721-93384743 TTGTATACAAATATTAATAATGG + Intergenic
1194819492 X:98488468-98488490 TTGCATACAAAAATTTATTGAGG - Intergenic
1194907353 X:99594437-99594459 ATGCACACATATATTTATTGTGG - Intergenic
1194923213 X:99793429-99793451 AAGTATAGAAGTATTAATTTGGG - Intergenic
1195061033 X:101194831-101194853 ATGTATATACATATAATTTGTGG - Intergenic
1195526401 X:105895167-105895189 ATGTATACAAACATTACTTTTGG + Intronic
1195810133 X:108819686-108819708 ATGCACACATATATTTATTGTGG - Intergenic
1197113153 X:122800171-122800193 AATTATAAAAATATTAATTTGGG - Intergenic
1197394754 X:125912868-125912890 ATGTATATATATATAAAGTGAGG - Intergenic
1197478500 X:126952419-126952441 ATGTACACATATGTTTATTGCGG + Intergenic
1197852106 X:130873587-130873609 ATGCACACATATGTTAATTGTGG + Intronic
1197931114 X:131697306-131697328 ACGTATACATATGTTTATTGCGG - Intergenic
1198050289 X:132945548-132945570 ATGCACACATATATTTATTGCGG + Intronic
1198524617 X:137488512-137488534 ATGCACACATATATTTATTGCGG + Intergenic
1199150330 X:144477061-144477083 ATGTATACATATATTTATAAAGG + Intergenic
1199413310 X:147550855-147550877 ATGTATAGAAACATTGATAGAGG + Intergenic
1199788150 X:151124319-151124341 ATGCACACAAATGTTTATTGTGG + Intergenic
1199869369 X:151883778-151883800 ATTTAAAAAAATTTTAATTGAGG + Intergenic
1199915050 X:152330392-152330414 ATGCATACATATGTTTATTGTGG + Intronic
1200366839 X:155675278-155675300 AAGTACACAAATATAATTTGTGG + Intergenic
1200625441 Y:5508648-5508670 TTGAATACAAATTTTTATTGCGG + Intronic
1200854692 Y:7924882-7924904 ATATATCCAAATATCATTTGTGG + Intergenic
1201272712 Y:12270880-12270902 ACTTATACAAAAATTAATTCAGG - Intergenic
1201401469 Y:13608540-13608562 ATTTACAAAAAGATTAATTGAGG + Intergenic
1201517446 Y:14833466-14833488 AATTATAAAAATATTAATTTGGG + Intronic
1201957445 Y:19641273-19641295 ATGTACACATATGTTTATTGAGG - Intergenic