ID: 995028615

View in Genome Browser
Species Human (GRCh38)
Location 5:107453439-107453461
Sequence ATGCTGAGCCTATTATATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995028613_995028615 25 Left 995028613 5:107453391-107453413 CCAACTGGGTCTTATGTATGTCA 0: 1
1: 0
2: 0
3: 4
4: 120
Right 995028615 5:107453439-107453461 ATGCTGAGCCTATTATATATGGG 0: 1
1: 0
2: 1
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995028615 Original CRISPR ATGCTGAGCCTATTATATAT GGG Intronic
901065575 1:6492632-6492654 ATGCTAAGCATGTTATATATGGG + Intronic
905045789 1:34999760-34999782 ATGGTGAGGCTGTAATATATGGG + Intronic
908568912 1:65388174-65388196 AAGCTGAGCCTATTCTAACTGGG + Intronic
909280752 1:73749711-73749733 TTGCTTAGCCTATTATATTGCGG - Intergenic
909770306 1:79414033-79414055 AGGAAGAGCCTATTAGATATAGG - Intergenic
910303077 1:85729394-85729416 TGGCTGAGCCTATTTTAAATGGG + Exonic
910763486 1:90758118-90758140 CTGTTGAGCATATTACATATTGG + Intergenic
911817994 1:102378887-102378909 ATGCTGAATTTATTATATTTAGG - Intergenic
912080368 1:105928984-105929006 AACCTGAGCCTTTTATATAAGGG - Intergenic
912179856 1:107206730-107206752 ATTCAGTGCCTAGTATATATTGG + Intronic
912869037 1:113286441-113286463 CTGCTGAGCCTAGCATATCTGGG + Intergenic
915471745 1:156129887-156129909 ATGCTGAGGCTATGGTAGATGGG + Intronic
916377580 1:164172300-164172322 ATCCTGTGCCTAATAAATATTGG + Intergenic
918641725 1:186849213-186849235 ATTCTGAACCTACTATATTTGGG + Intronic
918958622 1:191241435-191241457 ATTCTGAACATTTTATATATTGG - Intergenic
923552665 1:234976575-234976597 ATACTGAGCCTGTTTTAAATGGG + Intergenic
924436205 1:244046043-244046065 TTGCTCAGCCTGTTATATAGTGG + Intergenic
924684735 1:246277250-246277272 ATGTTGAGCGTTTTATATATAGG - Intronic
1062972186 10:1656773-1656795 TTAATGTGCCTATTATATATGGG + Intronic
1066489507 10:35881226-35881248 ATGCTGACAATAATATATATCGG + Intergenic
1076062356 10:127423312-127423334 GAGCTGAGCTTATTATATATCGG - Intronic
1079705179 11:23606979-23607001 ATTCTGATCCTATTAAATGTGGG + Intergenic
1081023610 11:37980262-37980284 ATGCTCATTCTATTATATTTTGG + Intergenic
1085858751 11:80207109-80207131 ATCCTGAGCCCATTAGTTATGGG - Intergenic
1088021371 11:105123701-105123723 TAGCTGAGTCTATTACATATCGG - Intergenic
1092276182 12:7062510-7062532 ATGCTGAGCCTACCATGTATGGG + Exonic
1093805014 12:23421685-23421707 ATGCTTAAGCTATTATCTATAGG - Intergenic
1096559746 12:52427231-52427253 GGGCTGAGCTTATTGTATATAGG + Intronic
1099789922 12:87320365-87320387 ATGCTGTGGCTTTAATATATGGG + Intergenic
1100251669 12:92831687-92831709 ATGCTGTGGCTATTTTGTATAGG - Intronic
1108916013 13:55612768-55612790 ATGCTGAGCCTATTATATTAGGG - Intergenic
1109288463 13:60441695-60441717 ATGCATAGCTAATTATATATTGG + Intronic
1111358529 13:87143256-87143278 ATACTGAGTTAATTATATATGGG + Intergenic
1116282118 14:42922321-42922343 GTTCAGAGCCTATTAAATATGGG + Intergenic
1117959915 14:61152657-61152679 ATGCTGAGATTATAATATTTTGG - Intergenic
1124325195 15:28754021-28754043 ATGTATAGCATATTATATATTGG + Intergenic
1124845610 15:33287052-33287074 ATGCTGGGCTTATTATTTAGGGG + Intergenic
1127505249 15:59591746-59591768 ACGCTGATCCAATTATACATGGG - Intergenic
1136780083 16:32893000-32893022 ATTCTGACCTTATTACATATAGG - Intergenic
1138907635 16:61356868-61356890 ATTCTGTGCCTATTTTTTATGGG - Intergenic
1144760122 17:17702412-17702434 ATTGTGAGCCTACTGTATATGGG + Intronic
1149359949 17:55884663-55884685 ATGCTGAGCCCTAGATATATTGG + Intergenic
1150169303 17:62975667-62975689 ATGATGAGACCAGTATATATTGG + Intergenic
1155805763 18:30169362-30169384 ATTATTATCCTATTATATATAGG - Intergenic
1158302747 18:56070460-56070482 AGGCTGAGCATATTATAATTAGG - Intergenic
1158379557 18:56914041-56914063 ATGCTGGGCCTTTTAAATGTGGG - Intronic
1159523133 18:69552027-69552049 TTGCTGAGCAAATTATATTTTGG + Intronic
1163316657 19:16545139-16545161 ATGCTGAGACTATGATACAAGGG + Intronic
1166129693 19:40738742-40738764 CTGCTGGGCATATTATATGTAGG - Intronic
927163707 2:20295765-20295787 ATGCTGAAATTATTATATTTTGG + Intronic
928026148 2:27740696-27740718 ATTCTGAAACTATTATACATAGG + Intergenic
928429360 2:31205145-31205167 ATACTGCGCCTAAGATATATGGG - Intronic
931102171 2:59014468-59014490 ATGCTGAACATATCATAAATGGG + Intergenic
931984865 2:67731542-67731564 GTGCTGAGCATATTACTTATTGG + Intergenic
936848158 2:116862945-116862967 ATGATGTGCCCATTATATACTGG - Intergenic
941685759 2:168446723-168446745 AGGCTGAGCCTTTTAAATCTGGG - Intergenic
943455243 2:188098828-188098850 ATGATGAGCCATTTATGTATTGG - Intergenic
945523267 2:210856079-210856101 ATGCTGACCCTATAATTCATAGG + Intergenic
1170290300 20:14761843-14761865 GTGCTCAGCCTATTGCATATTGG + Intronic
1172575791 20:36007475-36007497 ATGGAGGGCCTATTATATGTCGG + Intronic
1172864684 20:38086854-38086876 ATGCTTAGGCTATTATATTCTGG - Intronic
1173985366 20:47257439-47257461 ATGGTGAGCATATAGTATATGGG - Intronic
1177626372 21:23665692-23665714 ATTCTGAGCCTGTCATATATGGG - Intergenic
1181375863 22:22457496-22457518 ATGCTGAGCCTGATATGTTTGGG - Intergenic
949272062 3:2229304-2229326 AGGCTAAGTATATTATATATTGG - Intronic
949683784 3:6545124-6545146 ATGGTGATTCTATTATTTATCGG + Intergenic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
952138954 3:30457167-30457189 ATGCTAAGCCAAATATAAATGGG - Intergenic
955278994 3:57575736-57575758 ATGCTGAGTAAAGTATATATAGG - Intronic
956787944 3:72657977-72657999 CTGCAGAGCTTATTATAAATGGG + Intergenic
957716458 3:83935088-83935110 ATGCTGCGCTTGTTATAAATTGG + Intergenic
958078828 3:88718940-88718962 ATGATGTGCCTATTTTACATTGG + Intergenic
961365642 3:126397843-126397865 ATGCTGAGCCAAGTACAGATAGG + Intronic
963171847 3:142259097-142259119 TTGCTGAGCCTAAAACATATAGG + Intergenic
963502093 3:146140222-146140244 AAGCTGAGCCAATGCTATATGGG + Intronic
965352733 3:167634978-167635000 AAGCTATGCCTCTTATATATTGG + Intronic
971158482 4:24108518-24108540 CTCTTGAGCCTATTATATATAGG + Intergenic
971562455 4:28097966-28097988 ATGCTGAAATTATTATATAGAGG + Intergenic
977620924 4:99136227-99136249 ATGCTGGGTCAATTATATGTAGG + Intronic
981061361 4:140428378-140428400 CTGCTTTGCCTTTTATATATTGG + Intergenic
983085240 4:163435152-163435174 ATTCTGAGTTAATTATATATTGG + Intergenic
984006079 4:174310694-174310716 ATGCTGAGCATAAAATATAAAGG - Intronic
984691683 4:182733408-182733430 ATGCTGAGAATATCCTATATTGG + Intronic
987717487 5:21591122-21591144 ATTGTGATCCTATTATGTATGGG - Intergenic
987764294 5:22204964-22204986 AGGCTGAGCATATTATGCATAGG + Intronic
988819557 5:34867595-34867617 ATGGTGAGTCTATTATATTAGGG + Intronic
991420510 5:66436745-66436767 AGGGTGAGCCGATTATATGTTGG + Intergenic
991899027 5:71438094-71438116 AGGCTGAGCATATTATGCATAGG + Intergenic
992446849 5:76842132-76842154 ATGCTAAGAGTATTTTATATTGG + Intergenic
994435239 5:99721294-99721316 ATGTTTAGCCTATTAATTATTGG - Intergenic
995028615 5:107453439-107453461 ATGCTGAGCCTATTATATATGGG + Intronic
995861857 5:116649166-116649188 ATGCTGAGACTTTTTTAGATGGG - Intergenic
996703853 5:126477063-126477085 ATGCTCAGCCAGTTATATGTTGG - Intronic
1003431847 6:6046209-6046231 ATATGGAACCTATTATATATGGG + Intergenic
1003431851 6:6046240-6046262 ATATGGAACCTATTATATATGGG + Intergenic
1006973277 6:38069429-38069451 ACTTTGAGACTATTATATATCGG - Intronic
1007457019 6:41986524-41986546 TTGCTGATGCTATTATAAATGGG + Intronic
1008544388 6:52573011-52573033 ATTCTGAGCCTATCATTTGTAGG - Intronic
1008839422 6:55882580-55882602 ATTCTGATTCTATCATATATGGG - Intergenic
1010848189 6:80738244-80738266 ATGGTGAGCCCATTAGATAATGG - Intergenic
1010934001 6:81838510-81838532 ATGATTAGCATATTTTATATTGG - Intergenic
1011208433 6:84927656-84927678 AAGCTGTCCCTATTATAAATAGG - Intergenic
1012032003 6:94083043-94083065 ATACTTAGCCTAAAATATATAGG + Intergenic
1014776465 6:125516266-125516288 TTGCTGAGTTTATTATCTATTGG + Intergenic
1015103157 6:129505052-129505074 GCGCTAAGCCCATTATATATGGG - Intronic
1018084978 6:160293610-160293632 ATGATGAGGATATTATATTTTGG - Intergenic
1022074194 7:26950703-26950725 ATGCAGTACGTATTATATATAGG - Intronic
1024412094 7:49055423-49055445 AAACTGAGTATATTATATATTGG - Intergenic
1027336536 7:77156814-77156836 ATTCTGAGCCTGTCATATAGTGG + Intronic
1029779255 7:102714295-102714317 ATTCTGAGCCTGTCATATAGTGG - Intergenic
1031981166 7:128126351-128126373 ATGCTGTGCCCAGTATATATTGG - Intergenic
1034605694 7:152311448-152311470 ATTCTGAGTCTATTTTATTTGGG - Intronic
1037240141 8:16767982-16768004 AGTCTGAGCATATTACATATTGG - Intergenic
1039077289 8:33703242-33703264 ATTATGAGCCTATTATGTGTTGG + Intergenic
1039210601 8:35208760-35208782 ATGCTGACTCTATTATATAATGG - Intergenic
1041865466 8:62568313-62568335 ATGCTATCCCTATTAGATATAGG - Intronic
1043418756 8:80077857-80077879 ATTCTGAAACTATTATAAATTGG + Intronic
1055653650 9:78432702-78432724 CAGCTGGGCCTATTATATTTGGG - Intergenic
1055689538 9:78814749-78814771 ATGCTTTGCATATTATATAATGG - Intergenic
1055874066 9:80921679-80921701 ATACTAAGCCTTTTACATATAGG - Intergenic
1056530279 9:87480543-87480565 ATGCTTTGCCTATTATAAATAGG - Intergenic
1058032104 9:100211353-100211375 TTGGAGAGCCTTTTATATATAGG - Intronic
1186375958 X:9001728-9001750 ATGCAGAGCTTATTACATTTAGG + Intergenic
1188544635 X:31290669-31290691 ATCCTAAGCATCTTATATATAGG + Intronic
1188893700 X:35641389-35641411 ATGTTGTGCCAATTAAATATGGG + Intergenic
1194309265 X:92284184-92284206 ACGATGAGACTATTTTATATTGG - Intronic
1197559642 X:128001855-128001877 ATGTAAACCCTATTATATATTGG - Intergenic
1198673993 X:139112316-139112338 ATGGAGAGCCTACTATATGTTGG - Intronic
1199576655 X:149318978-149319000 TTGCTGAGCCTAATGGATATCGG - Intergenic
1200617563 Y:5398429-5398451 ACGATGAGACTATTTTATATTGG - Intronic
1202041438 Y:20689414-20689436 ATGCTGAGCATTTTATTTATTGG + Intergenic