ID: 995031945

View in Genome Browser
Species Human (GRCh38)
Location 5:107491136-107491158
Sequence CACCATTAGGGACAGGACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995031940_995031945 11 Left 995031940 5:107491102-107491124 CCGTAATAAAATGTTCAGAGACT 0: 1
1: 1
2: 1
3: 31
4: 274
Right 995031945 5:107491136-107491158 CACCATTAGGGACAGGACATAGG 0: 1
1: 0
2: 1
3: 9
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995031945 Original CRISPR CACCATTAGGGACAGGACAT AGG Intronic
900782912 1:4629493-4629515 CTCCTGCAGGGACAGGACATGGG - Intergenic
901362929 1:8719264-8719286 CACCACTAGGGAGAGCACAGTGG + Intronic
901380621 1:8871455-8871477 CACCATTCAGGGCAGGTCATTGG + Intronic
904078359 1:27856701-27856723 CACCAGTAGGCACAGGATTTCGG - Intergenic
904184679 1:28694532-28694554 CAGCCTTAGTGACAGAACATGGG - Intronic
905043479 1:34978471-34978493 CACAAATAGTAACAGGACATTGG - Intergenic
912566929 1:110594157-110594179 AATTATTAGAGACAGGACATGGG + Intronic
916920338 1:169460034-169460056 CAGCATTTGGGACAGCACTTGGG + Intronic
920577859 1:207075182-207075204 CAGCATTAGAGACAGGTCACTGG + Exonic
923734338 1:236589007-236589029 CTCCATTGATGACAGGACATAGG - Intronic
1064518613 10:16177180-16177202 CACCTCTAGGGGCAGGGCATAGG - Intergenic
1064677123 10:17772099-17772121 CACTGTTAGGTACAGGGCATAGG + Intronic
1069058710 10:63871590-63871612 GAGCATTTGGGAGAGGACATGGG + Intergenic
1072661270 10:97364914-97364936 CACCAAGGGGGACAGGAGATGGG + Intronic
1072925837 10:99616013-99616035 CACCCTTATGGAGAGGACCTGGG + Intronic
1076621553 10:131792358-131792380 CACCACTGGGGACAGGAAACTGG + Intergenic
1077311138 11:1889588-1889610 CAACTTTGGGGACAGGGCATGGG + Exonic
1077771549 11:5224661-5224683 CACCATAAGGGACATGATAAGGG + Intergenic
1079360997 11:19770358-19770380 CACCTCTAGGGTCAGGGCATGGG - Intronic
1084175724 11:67421248-67421270 CACCACTCGGGCCAGGACCTGGG - Intronic
1085424427 11:76391397-76391419 CAGCATTTGGCCCAGGACATAGG - Intronic
1086518328 11:87640644-87640666 CACCATGGTGGAAAGGACATGGG - Intergenic
1088188232 11:107197316-107197338 GACCTTGAGGGAAAGGACATTGG - Intergenic
1096165243 12:49417099-49417121 CTTCAGTAGGGACAGGACCTGGG + Intronic
1097184808 12:57190870-57190892 CTCGATAAGGGTCAGGACATTGG - Exonic
1100079973 12:90837307-90837329 CACCATTTTGGACAGGAATTTGG + Intergenic
1105326907 13:19378761-19378783 CAACATGAGAGACATGACATGGG - Intergenic
1109613330 13:64795302-64795324 CATCATCAGTGACAGAACATTGG - Intergenic
1113344150 13:109457656-109457678 CAACAGTAGGGATAGGACCTGGG - Intergenic
1113543324 13:111125719-111125741 CTACTTTAAGGACAGGACATTGG - Intronic
1115238249 14:31228997-31229019 GACCATTAATGAAAGGACATAGG - Intergenic
1115441014 14:33435756-33435778 CATCGAAAGGGACAGGACATAGG - Intronic
1119856660 14:77906165-77906187 CAGAATTAGGAACAGGAAATAGG + Intronic
1120848675 14:89148981-89149003 CACCAATAGAGACAGGACTTTGG + Intronic
1132839902 16:1973914-1973936 CAACAGCAGGGACAGGGCATGGG - Intronic
1133112651 16:3557776-3557798 CATCATCAGGGTCTGGACATAGG + Intronic
1138575816 16:57906726-57906748 CACCAACAGAGAGAGGACATAGG + Intronic
1143040588 17:4033017-4033039 CTCCATTAGGGGCAGTACACAGG + Intronic
1148443837 17:47725921-47725943 CACCACTAGGGGCAGGACAGAGG - Intergenic
1150212703 17:63450167-63450189 CAGGATTAGGTACAGGGCATAGG + Intergenic
1151672747 17:75580787-75580809 CACCCAAAGGGACAGGAGATTGG + Intergenic
1153308357 18:3653092-3653114 CACCAGTAGGGCCAAAACATTGG - Intronic
1159233644 18:65642424-65642446 CAACATTAGGGAAAGCAAATGGG - Intergenic
1160379333 18:78439630-78439652 CACCCTTAGGGCCAGGACAAAGG + Intergenic
1160882760 19:1329395-1329417 CGCCAATTAGGACAGGACATCGG + Intergenic
1163491752 19:17620836-17620858 CACCATTAGACCCAGGACCTGGG - Intronic
1168169547 19:54576449-54576471 CACCCATGGGGTCAGGACATAGG - Intronic
925267408 2:2575826-2575848 CTCCATTAGGTAGAGGACATTGG - Intergenic
928783660 2:34854983-34855005 CACCATGAAGGGAAGGACATAGG + Intergenic
930801778 2:55450218-55450240 CTCCAGTAGGCACAGCACATAGG + Intergenic
930802272 2:55455321-55455343 CTCCAGTAGGCACAGCACATAGG + Intergenic
932105559 2:68937997-68938019 CAGCATTAGGGATAGGAAGTTGG - Intergenic
932578393 2:72975989-72976011 CACCATTAGGGAACTCACATGGG + Intronic
935282219 2:101528028-101528050 CATCAGAAGGGACAGGACACTGG - Intergenic
935743051 2:106167859-106167881 CACCATAAGATACAGGTCATGGG + Intronic
939617567 2:144378167-144378189 CACCATGTGGAACAGGAGATAGG + Intergenic
946174951 2:217916895-217916917 CACCATGAGGGACAGAGAATGGG + Intronic
1178356112 21:31911841-31911863 AAGAATTGGGGACAGGACATGGG - Intronic
1180879362 22:19192929-19192951 CAGCAGCAGGGCCAGGACATGGG + Intronic
959917709 3:111836513-111836535 AAGCATTAGGGACAGGGCTTAGG + Intronic
962706310 3:138048178-138048200 CAGCATCAGTGACAGGAGATAGG - Intergenic
963361512 3:144279203-144279225 AACCATTAGGGACAGCACATTGG - Intergenic
964891142 3:161537043-161537065 CAACATTAAGAACAGAACATTGG + Intergenic
965028371 3:163331008-163331030 CACCATTAATCAGAGGACATGGG + Intergenic
965520579 3:169665319-169665341 CACCTTTATGCACAGGACAGCGG - Intergenic
966240727 3:177752875-177752897 AACCATCAGGGACAGGAGAGCGG - Intergenic
966368990 3:179226281-179226303 CACCATTAGGAACAAGACAAAGG + Intronic
967229908 3:187327874-187327896 CACAATTAGGGACAGGAAAGAGG + Intergenic
968853621 4:3101998-3102020 CACCATGAGGGTCAGGTCAAGGG + Intronic
969747127 4:9081126-9081148 CACCTCTAGGGACAGGGCATTGG + Intergenic
970598348 4:17620294-17620316 TACCTTTAGGGACAGAACTTGGG - Intronic
972970460 4:44568637-44568659 AAGCACTAGGGACAGGACAGAGG - Intergenic
979454475 4:120911418-120911440 CTCCATTATGGGCTGGACATTGG - Intronic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
993474934 5:88352801-88352823 CACCATTAGGAACATAAAATTGG + Intergenic
995031945 5:107491136-107491158 CACCATTAGGGACAGGACATAGG + Intronic
995287120 5:110402573-110402595 CACAATCAGTGACAGGACTTGGG + Intronic
997441033 5:133908781-133908803 CACCATCACGTACAGGACATTGG - Intergenic
1001794537 5:174491097-174491119 CAGCAAGAGAGACAGGACATAGG + Intergenic
1005271157 6:24164879-24164901 CCCCATTAAGGACTTGACATTGG + Intergenic
1006548874 6:34803715-34803737 TGGCATTGGGGACAGGACATGGG + Intronic
1008330074 6:50234515-50234537 CACCATTTGAGACAGGACTGTGG + Intergenic
1015166542 6:130206019-130206041 CACCATCTGAGATAGGACATTGG + Intronic
1023889645 7:44383031-44383053 CACCCCTGGGGACAGGACCTAGG - Exonic
1028213635 7:88105670-88105692 CAACATTGGGGATAGGACACAGG + Intronic
1032318820 7:130866338-130866360 GACCAATAGTGACAGGACAGTGG + Intergenic
1033961785 7:146922417-146922439 CACCACTACGTTCAGGACATGGG - Intronic
1035923669 8:3705140-3705162 CACCACCAGGGACAGGGCAGTGG + Intronic
1037931729 8:22884764-22884786 CAAAATTAAGGAGAGGACATTGG - Intronic
1037933999 8:22902387-22902409 GTCCATTACGGACATGACATGGG - Intronic
1038752754 8:30312377-30312399 CACTATTAGGGAGAGAGCATGGG - Intergenic
1042905312 8:73766403-73766425 CACCATCAGAGACATGCCATAGG + Intronic
1045143512 8:99313746-99313768 CACCTCTGGGGACAGGGCATAGG - Intronic
1052681044 9:31693122-31693144 CACTCTTAGGGAAAGGTCATAGG + Intergenic
1054667202 9:67746648-67746670 CAGCATTCTGGAAAGGACATAGG + Intergenic
1057342111 9:94212145-94212167 GACCATGAGGGGAAGGACATGGG - Intergenic
1058422683 9:104847674-104847696 TACAATTAGAGACAGCACATTGG - Intronic
1058494384 9:105539661-105539683 GGCCATTAGGGACTGGAAATGGG - Intronic
1058645966 9:107131616-107131638 CCCCATTAGGGACAGGAGAAAGG + Intergenic
1059920930 9:119159065-119159087 CACCATAAGAGACGGGAAATTGG + Intronic
1060419158 9:123455167-123455189 CTCCTTTAAGAACAGGACATGGG - Intronic
1192812643 X:74560535-74560557 CACCCTGAAGGAAAGGACATAGG + Intergenic
1195647203 X:107245813-107245835 CGTAATTAGGGCCAGGACATAGG - Intergenic
1202604902 Y:26630838-26630860 CAACATGAGAGACAAGACATGGG + Intergenic