ID: 995034557

View in Genome Browser
Species Human (GRCh38)
Location 5:107518490-107518512
Sequence CTGGGGGACTGGTGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 847
Summary {0: 1, 1: 1, 2: 8, 3: 88, 4: 749}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995034547_995034557 8 Left 995034547 5:107518459-107518481 CCACTGTGGAGAACAATGGAACA 0: 1
1: 0
2: 2
3: 14
4: 297
Right 995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG 0: 1
1: 1
2: 8
3: 88
4: 749

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995034557 Original CRISPR CTGGGGGACTGGTGGGCAGA AGG Intronic
900183768 1:1323912-1323934 CTGGGGGACTGGGGGGCTGAGGG + Intronic
900183776 1:1323928-1323950 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900183784 1:1323952-1323974 CTGGGGGTCTGCTGGGCTGAGGG + Intronic
900183796 1:1323976-1323998 CTGGGGGACTGAGGGGCTGGGGG + Intronic
900183802 1:1324000-1324022 CTGAGGGTCTGCTGGGCTGAGGG + Intronic
900183811 1:1324024-1324046 CTGGGGGACTGGAGCGCTGGGGG + Intronic
900183819 1:1324040-1324062 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183824 1:1324056-1324078 CTGAGGGACTGAGGGGCTGAGGG + Intronic
900183839 1:1324096-1324118 CTGGGGAGCTGGGGGGCTGAGGG + Intronic
900183857 1:1324136-1324158 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183865 1:1324152-1324174 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900183880 1:1324192-1324214 CTGGGGAGCTGGGGGGCTGAGGG + Intronic
900252514 1:1678494-1678516 CTGGCGGTGTGATGGGCAGACGG - Intronic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
900459911 1:2798110-2798132 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900459941 1:2798199-2798221 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900459977 1:2798295-2798317 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900460024 1:2798439-2798461 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900460066 1:2798575-2798597 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900460101 1:2798679-2798701 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900460116 1:2798727-2798749 CTGGGAGGCTGGGGGGCTGAGGG - Intronic
900482372 1:2905418-2905440 CTGGGGGGCTGGAGCACAGAGGG - Intergenic
900589886 1:3454818-3454840 CTGGGGGACAGGTGAGCCGGGGG + Intronic
900767773 1:4516784-4516806 CTGGGGACAAGGTGGGCAGAGGG + Intergenic
900797822 1:4719910-4719932 CTGGGGGCCTGGTGGGACCATGG + Intronic
901022293 1:6261398-6261420 CTGGGGGCCCGGGGGCCAGAGGG + Intergenic
901032108 1:6313148-6313170 CTGGGGGACAGGGGTGGAGAAGG + Intronic
901198502 1:7453618-7453640 GAGGGGGACATGTGGGCAGATGG + Intronic
901559436 1:10058569-10058591 CTGGGGGAGTGGTGTGCACTGGG + Intronic
901751783 1:11414404-11414426 ATGAGGGATTGGAGGGCAGAGGG + Intergenic
902242646 1:15099171-15099193 CTGGGAGGCTGATGGGCAGAGGG + Intronic
902392769 1:16115885-16115907 GTGGGGGACTGGGGGGCAGGAGG + Intergenic
902768745 1:18633477-18633499 CTGCGAGGCTGGTAGGCAGATGG - Intronic
902776084 1:18675929-18675951 CAGGGATGCTGGTGGGCAGATGG - Intronic
902803696 1:18847514-18847536 GTCGGGGACTGGGGGGAAGAGGG + Intronic
902878073 1:19352944-19352966 CTGGGGCACGAGTGGGCACAGGG + Intronic
903004420 1:20289357-20289379 TGGGGGGACTGCTGGGCAGAGGG - Intergenic
903070419 1:20724396-20724418 CAGAGGGGCTGGTGGGCAGTGGG - Exonic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903597069 1:24502992-24503014 CTGGGAGCCTGGTGGGCGGCGGG - Exonic
903622415 1:24707564-24707586 CTGGCAACCTGGTGGGCAGAGGG + Intergenic
903680503 1:25093277-25093299 CTCTGGGACTGGTGGGCTGGGGG - Intergenic
904311545 1:29632677-29632699 CTGGGGGACTGAGGGACTGAGGG - Intergenic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904311589 1:29632797-29632819 CTGGGGGACTGGGGGGCTGGAGG - Intergenic
904378453 1:30095977-30095999 AAGGGGGGCTGTTGGGCAGAAGG - Intergenic
904597408 1:31655571-31655593 CTGGGGGCCTGGTGGGAGGGTGG - Intronic
904826053 1:33274510-33274532 GTAAGGGATTGGTGGGCAGAGGG + Intronic
904896895 1:33824380-33824402 CTCAGGGACTGGATGGCAGAGGG - Intronic
905040052 1:34948218-34948240 CGGGGTGACGGCTGGGCAGAGGG - Intergenic
905207776 1:36352756-36352778 GTGGAGGACTGGCGTGCAGAGGG - Intronic
905482373 1:38270516-38270538 CAGGGGGACTGCCAGGCAGAGGG - Intergenic
905739994 1:40361708-40361730 CTGGGGCACTGGTGGCCACAGGG + Intronic
905864225 1:41367982-41368004 ATGGGGTACTGCTGGGGAGAAGG - Intronic
905875676 1:41430872-41430894 CTGGGGAAAAGGTGGGCAGTGGG + Intergenic
905878004 1:41445680-41445702 CTGGCAGACAGGTGGGCAGATGG + Intergenic
906209990 1:44007412-44007434 CTGGGGAACCCCTGGGCAGAGGG - Intronic
906356981 1:45115381-45115403 CTGGGCGGCTGCTGGGCGGAGGG + Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907870081 1:58435128-58435150 ATGGGAGATTGGTGGGCAGGAGG + Intronic
910502411 1:87908034-87908056 GTGGGGGTGGGGTGGGCAGAAGG + Intergenic
912806459 1:112760372-112760394 CTAGGACACTGGCGGGCAGAGGG + Intergenic
912812682 1:112805755-112805777 CTGGAGGTCTGGTGGGGAGGTGG + Intergenic
912945131 1:114078377-114078399 GGAGGGGACTGGTGGCCAGAAGG + Intergenic
912952729 1:114131577-114131599 CTTGGGGACTTGGGGGCACAGGG + Intronic
913518504 1:119624316-119624338 CTGAAGAACTGGTGGGCAGAGGG - Intronic
914814747 1:151055217-151055239 CTAAGGGCCTGGTGGGAAGAGGG + Intronic
914953959 1:152144921-152144943 CGGGGTGGCTGCTGGGCAGAGGG + Intergenic
915407314 1:155670581-155670603 TTTGGGGAGTGGTAGGCAGATGG - Intronic
915420059 1:155773329-155773351 TTGGGGGGATGGTGGGCAGATGG - Intronic
915639265 1:157209677-157209699 GCGGGGGACTGAGGGGCAGAGGG - Intergenic
916453786 1:164949240-164949262 CAGGAGAACTGGTGGGCTGAGGG + Intergenic
916669493 1:167001244-167001266 TTTGGGGACTTGGGGGCAGAAGG + Intronic
916784743 1:168078357-168078379 CTGGAGGACTAGTGGGGTGAAGG + Intergenic
917136579 1:171793980-171794002 CTGGGGTAGTAGGGGGCAGATGG - Intronic
917535591 1:175872191-175872213 CTGGGGAACTGGGGGACTGAGGG + Intergenic
917591467 1:176480761-176480783 CTGAGGGAGGGGTGGGGAGAGGG - Intronic
918380025 1:183944654-183944676 CTTGGGGACTGATGACCAGAAGG + Intronic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919768680 1:201143454-201143476 CTGGTGGACTGGACGGCAGCAGG - Intronic
919778006 1:201206596-201206618 CTGGAGGACTGGGGAGCAGCAGG + Exonic
919796712 1:201325366-201325388 CTGGGGGACTCGGGGGCACAAGG + Intronic
919887857 1:201947838-201947860 TGGGGGGACTGAAGGGCAGAAGG + Intergenic
920750170 1:208666811-208666833 CTTGGGGCCTGCTGGGCTGATGG + Intergenic
922648867 1:227319017-227319039 CTGGGGGGCCGGTGGGGAGCAGG - Intergenic
922823038 1:228497458-228497480 GTGGGGGACTGGCGGGGAGCAGG - Intergenic
923557707 1:235013723-235013745 CTGGAAGAGGGGTGGGCAGATGG + Intergenic
924139865 1:241011266-241011288 CTTGGGGACTGAAAGGCAGAAGG + Intronic
1063385480 10:5613779-5613801 ATGGGGGACTAGGGGCCAGAGGG + Intergenic
1064016070 10:11773272-11773294 ATGGAGGACTGGTGGGAAGGTGG - Intergenic
1065093453 10:22258667-22258689 CTGAGGGGCAGGTGGTCAGATGG - Intergenic
1065322793 10:24524607-24524629 CTGGGGGACGGCTGGGGAGCTGG - Exonic
1065738068 10:28771968-28771990 CTGGGCGGCTGCAGGGCAGAGGG - Intergenic
1066048598 10:31615916-31615938 CTGGGGGAAAGGTAGGCAGGTGG + Intergenic
1066469679 10:35686464-35686486 TTGGGAGACTGGTGGGGATAGGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067055486 10:43047463-43047485 CTGGGTGTTTGGTGGGCACATGG - Intergenic
1067452205 10:46388688-46388710 CAAGGGGAATGGGGGGCAGAGGG + Intronic
1067513087 10:46911516-46911538 CTGGGGGCCAGGTGGGCAGGGGG + Intronic
1067585032 10:47471067-47471089 CAAGGGGAATGGGGGGCAGAGGG - Intronic
1067649166 10:48140326-48140348 CTGGGGGCCAGGTGGGCAGGGGG - Intergenic
1067699409 10:48557844-48557866 TTGGGGGCCTGGGGAGCAGAGGG + Intronic
1068963516 10:62888931-62888953 CTGGAGCACTGGTGGACAGCAGG + Intronic
1069581955 10:69572510-69572532 CTGGGAGACTGGGGAGTAGAGGG + Exonic
1069643044 10:69968601-69968623 CTGGAGGCCTTGGGGGCAGAGGG - Intergenic
1069732989 10:70631258-70631280 CTGGGCGGCTGCCGGGCAGAGGG - Intergenic
1069942259 10:71964082-71964104 CCCGGGGACTGGAGGGCCGAGGG + Intergenic
1070140171 10:73732895-73732917 CTGGGGGCGTGGGGGGCAGTGGG - Intergenic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1070793761 10:79205038-79205060 CAGATGGACTGGTGGACAGATGG + Intronic
1070814345 10:79313448-79313470 CTTGGGGACTGGTGGGGAAGAGG + Exonic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071545418 10:86525245-86525267 CTGGGGGAGTTGTAGGCAGAGGG - Intergenic
1072038935 10:91589767-91589789 CTGGGGGAGTGTGGGGGAGAAGG + Intergenic
1073107342 10:101039682-101039704 CAGGGGCCTTGGTGGGCAGATGG + Exonic
1073327000 10:102648915-102648937 CTGGGGTAGGGGTGGGCAGCTGG - Intronic
1073432355 10:103494496-103494518 CTGGAGGACTGGGGCGCAGGTGG + Intronic
1073592768 10:104772203-104772225 CTAGGGGACTGGTGGGGTGGTGG + Intronic
1073867150 10:107818210-107818232 CTGGGGGCCAGGTGGGGAGCAGG + Intergenic
1074716358 10:116223162-116223184 CTGGGGGGCTAGTGGGTAGAGGG - Intronic
1074886633 10:117699205-117699227 ATGGAGGAAAGGTGGGCAGAGGG + Intergenic
1075071907 10:119325398-119325420 CTGGGTTGCTGGTGTGCAGAAGG + Intronic
1075108534 10:119559645-119559667 CGGGGCGGCTGCTGGGCAGAGGG + Intergenic
1075719547 10:124576706-124576728 CGGGGGTACTGGGGGGCTGAGGG + Intronic
1076017905 10:127043658-127043680 CTGGGGCACAGACGGGCAGAGGG - Intronic
1076202424 10:128569178-128569200 CTGGGGGTCTTGGTGGCAGATGG - Intergenic
1076225503 10:128771635-128771657 CTGGAGGAGTGGTGGGAAGGGGG + Intergenic
1076495933 10:130897963-130897985 CTGGGGTCCTAGTGGGCAGGGGG + Intergenic
1076608867 10:131707915-131707937 CAGGGGGATCAGTGGGCAGAGGG + Intergenic
1076744046 10:132503945-132503967 CTGGGGGTGTGGTGGACAGGTGG - Intergenic
1076842740 10:133054224-133054246 CTGGGTCAATGATGGGCAGATGG + Intergenic
1076870368 10:133189876-133189898 ATGGGGGGCTGCTGGACAGATGG - Intronic
1076910417 10:133385342-133385364 CTGGGTTGCTGGTGGGCAGCCGG + Intronic
1077101332 11:823864-823886 CTGGGGGACGGGAGGGGAGGAGG + Intronic
1077186684 11:1238621-1238643 CAGATGGACAGGTGGGCAGATGG + Intronic
1077217703 11:1401987-1402009 CTGGGGGACTGGCCAGCAGGAGG - Intronic
1077358081 11:2127786-2127808 CTGGGGGACTGCAGGGCTGGGGG + Intergenic
1078091642 11:8268044-8268066 CTGGGAGACTGGCTGGCAGTGGG + Intronic
1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG + Intronic
1078416012 11:11165459-11165481 CTGGTGGGCAGGTGTGCAGAGGG - Intergenic
1078602852 11:12748866-12748888 CAGGGGGACTGGGGGTCAAATGG + Intronic
1079031717 11:16991138-16991160 CTGGGAGTCTCGGGGGCAGAGGG - Intronic
1081577123 11:44326106-44326128 CTGGAAGCCTGGTGGGCAGAAGG + Intergenic
1082175616 11:49055668-49055690 CAGGGGGTGTGATGGGCAGAGGG - Intronic
1083177592 11:60961041-60961063 CTGAGAGACTTGAGGGCAGAAGG + Intergenic
1083276042 11:61597703-61597725 ATGGGGAAATGGGGGGCAGAGGG - Intergenic
1083380610 11:62265312-62265334 CTGGGGGTCAGGTAGGAAGAAGG - Intergenic
1083493551 11:63030919-63030941 CTGGGGGGCTGTGGGGGAGACGG + Intergenic
1083594219 11:63911414-63911436 CAGGGGGGGAGGTGGGCAGAGGG - Exonic
1083705564 11:64511966-64511988 CTGGGTGGCAGGTGGGGAGAAGG + Intergenic
1083750704 11:64759204-64759226 GTGGGGGAGGGGCGGGCAGACGG - Intronic
1083791575 11:64989436-64989458 CTGGGGGACAGCTGGACAGGAGG + Exonic
1083887890 11:65581607-65581629 CTGGGGGACTGGGGGCCGGAGGG - Exonic
1084004423 11:66315481-66315503 ATAGGGGGCTGGTGGGCAGGAGG + Exonic
1084026304 11:66452251-66452273 CTGGGGGACAGGGAAGCAGAGGG + Intronic
1084205047 11:67586324-67586346 CTGGAGGAATTGGGGGCAGAGGG - Intronic
1084422383 11:69066801-69066823 CTGGAGGCTTGGTAGGCAGAGGG + Intronic
1084456769 11:69272393-69272415 CAGTGGGACAGGTGGGCAGATGG - Intergenic
1084548759 11:69828232-69828254 CTTGGGGTCTGATGGGCAGACGG + Intergenic
1085309728 11:75509080-75509102 CTGGGTGGCTGGTGGGCATAGGG - Intronic
1085315021 11:75539592-75539614 CTGGGAGATTGGAGGGCAGGGGG + Intergenic
1085464287 11:76713547-76713569 TTGGTGGGCTGGTGGGTAGATGG + Intergenic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1087701531 11:101441315-101441337 TTGGGGAAATGGGGGGCAGATGG - Intergenic
1088047239 11:105468897-105468919 CTGAAGTACTGGTGGGCAAAGGG - Intergenic
1089338730 11:117743496-117743518 TTGGGGAACTGGTGGGCAGATGG - Intronic
1089492383 11:118892147-118892169 CTGCGGGAAGGGTTGGCAGATGG + Intronic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1089586632 11:119513659-119513681 CTGGGGGCCCTGTGAGCAGATGG + Intergenic
1089650121 11:119907488-119907510 CTGGGTGGCTGGTGGACAGGTGG + Intergenic
1090413765 11:126526898-126526920 GTTAGGGACTGATGGGCAGAGGG - Intronic
1090453458 11:126826984-126827006 CTGGGATTATGGTGGGCAGAGGG + Intronic
1090809434 11:130223690-130223712 CCGGGGGAGTGGGGGGCAGGAGG + Intergenic
1090837322 11:130462803-130462825 CTCGGGGACTGCTGGGAGGAGGG + Intronic
1091102347 11:132886713-132886735 CTGGGGGAGTCGTGGCCAGCTGG + Intronic
1091337443 11:134783029-134783051 CTTGGGGAGTGATGGGAAGAAGG - Intergenic
1092149280 12:6236086-6236108 CGGGAGAACTGGTGGGCAGAGGG - Intronic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1092795199 12:12103975-12103997 CTGGGTGACTGGGTGACAGAGGG + Intronic
1093612739 12:21182528-21182550 GGGAGGGACTGGCGGGCAGAAGG - Intronic
1094239052 12:28201192-28201214 CGGGGTGACTGCTGGGCGGAGGG + Intronic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1096774962 12:53958024-53958046 CTGGGGGACTCTTGGGGAGAAGG - Exonic
1096891131 12:54772674-54772696 GTGGGGGGCTGGTGGGGAGGTGG - Intergenic
1097025856 12:56054965-56054987 ATGGGTGACTGGAGGGCAAATGG + Intergenic
1097290928 12:57914310-57914332 TTTGGGGACTTGTGGGGAGAAGG - Intergenic
1098038688 12:66333232-66333254 CAGGGGGTGTGGTGGGCAGGAGG + Intronic
1098680524 12:73348158-73348180 CTAGGGTAATGGTGGGGAGAGGG + Intergenic
1099973599 12:89524933-89524955 CTGGGGGCCGGGATGGCAGAGGG + Intronic
1100386749 12:94110914-94110936 CCGGGGTACAGGTGGGAAGAGGG - Intergenic
1100614342 12:96219589-96219611 TAGGGGGACAGGTGGGCAGTGGG - Intronic
1101736203 12:107465198-107465220 TCGGGGCACTGGAGGGCAGACGG - Intronic
1102543924 12:113641338-113641360 ATGGGGGACTGGGGGACATAGGG - Intergenic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1102952983 12:117042357-117042379 CTGGGGGGCTGGTGGTGAGGTGG - Intronic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103447255 12:121002234-121002256 CTGGGGGCCTGGCTGGCTGAGGG + Exonic
1103607259 12:122096565-122096587 CTAGGGGAATGGTGGTCAGCAGG + Intronic
1104179073 12:126360698-126360720 GTGGGTGACTGGTGGGGAGAAGG + Intergenic
1104866790 12:131960761-131960783 CTGGGAGACTGGGGTGCCGACGG - Exonic
1104950243 12:132436790-132436812 CGGGGGGACAGGTGGGCTCAGGG - Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105210514 13:18254342-18254364 GTGGGGGACTGGGGTGGAGAGGG - Intergenic
1105223876 13:18409174-18409196 GTGGAGGAGTGGTGGGCAGCGGG + Intergenic
1106013628 13:25847905-25847927 CTGGGGTGCTGCTGGGCAAAGGG - Intronic
1106144840 13:27041242-27041264 CAGGGAGACTGCAGGGCAGATGG - Intergenic
1106149846 13:27088601-27088623 TTGGGGGCATGGTAGGCAGAGGG + Intronic
1106300509 13:28460093-28460115 CTGGGTGATGGTTGGGCAGATGG - Intronic
1106305037 13:28501839-28501861 CTGGCTGACTGCTGGGCAGATGG - Intergenic
1106379817 13:29225166-29225188 CTGGGAGCCTGGTGAGCTGAAGG + Intronic
1107265438 13:38548011-38548033 ATGGGGCACTGGTGAGGAGACGG - Intergenic
1108128049 13:47266588-47266610 ATGCGGGACAGGTAGGCAGAAGG - Intergenic
1108807809 13:54181420-54181442 CAGGGCTACTTGTGGGCAGAGGG - Intergenic
1109150045 13:58835742-58835764 CTGGAGGAGTGGGGAGCAGAGGG - Intergenic
1109924920 13:69124155-69124177 TTGGGGGAATGGTGGGAGGAGGG + Intergenic
1110395322 13:75023373-75023395 CTGGTGTCCTGGTGTGCAGATGG - Intergenic
1111838614 13:93421164-93421186 CTGTGAGACTGTTGGGCAAATGG + Intronic
1112205426 13:97319342-97319364 CTGGGGGAGTGCTGGCCAGGCGG + Intronic
1112338903 13:98536900-98536922 CTGGGCGACTGGAGGACAGGCGG - Intronic
1113578801 13:111413880-111413902 CTGGGTGTGTGGTGGGCATATGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113934911 13:113988872-113988894 ATGGGTGAGTGATGGGCAGATGG - Intronic
1115259469 14:31437414-31437436 CGGGGCGGCTGCTGGGCAGAGGG + Intronic
1116149982 14:41128702-41128724 CTGGGGGGCTGGAGGGCTGGGGG - Intergenic
1117495452 14:56297658-56297680 CAGTGTGACTGGTGGACAGATGG + Exonic
1118253186 14:64182913-64182935 CGGGGTGACGGCTGGGCAGAGGG + Intronic
1118839679 14:69501029-69501051 CTGGGATCCTGGTGGGCACAGGG + Intronic
1118980200 14:70710083-70710105 CTGGGAGGTGGGTGGGCAGACGG - Intergenic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120193776 14:81462499-81462521 CAGGGCGGCTGGTGGGCGGAGGG + Intergenic
1120547586 14:85829856-85829878 CAGGGTGGCTGCTGGGCAGAGGG + Intergenic
1120682933 14:87502521-87502543 CTGGGGCATTGGTGGTCAGAAGG - Intergenic
1120700991 14:87698633-87698655 CTGGGTGCCTGATTGGCAGAGGG - Intergenic
1120989445 14:90362244-90362266 CTGGGGTACTGGGGAGCAGGAGG + Intergenic
1121515709 14:94548528-94548550 CTGGAGCCATGGTGGGCAGAGGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121586860 14:95068547-95068569 CTTGGGGACTGGGGGACAGCTGG + Intergenic
1122070727 14:99203967-99203989 CTGGGGGACCTGGGGGCTGATGG - Intronic
1122203707 14:100137815-100137837 CTGGGGGACATGTGAGCAGGAGG - Intronic
1122214255 14:100192945-100192967 CAGGGAGACTGGTCGGCAGGGGG - Intergenic
1122267335 14:100552835-100552857 CCTGGTGACTGCTGGGCAGACGG + Intronic
1122542434 14:102505789-102505811 CTGGGGGCAGGGTGGGCAGCAGG + Exonic
1122671897 14:103379080-103379102 CTGGGGTACTGGAAGCCAGAAGG + Intergenic
1122703355 14:103605087-103605109 CTGGGGTACTGCTGGGCGGAAGG - Intronic
1122872073 14:104643386-104643408 CTGGGGGGCGGGTGGGTAGCAGG - Intergenic
1122970546 14:105150440-105150462 CTGGGTGCCAGGTGGGCAGGCGG - Intronic
1122972489 14:105158080-105158102 CGGGGGGAGAGGTGGGCAAAGGG + Intronic
1123044653 14:105505382-105505404 CCGGGGGCCAGGTGGGCAGGCGG + Intergenic
1123696587 15:22883313-22883335 CTGGGAGACTGGGAGGCAGGGGG - Intronic
1124372299 15:29110689-29110711 GTGGAGCACTGGTGGGGAGAGGG + Intronic
1125933346 15:43615603-43615625 CTGGGAGACTGGAGAGCAGTAGG + Exonic
1125946444 15:43715065-43715087 CTGGGAGACTGGAGAGCAGTAGG + Intergenic
1128087964 15:64898691-64898713 CTGGGGATCTGGAGGGCAAATGG + Intronic
1128309440 15:66621361-66621383 CTTGGGGACGGGTGGGGTGAAGG + Intronic
1128498506 15:68211394-68211416 CTGGGAGAAGGGTGGTCAGAGGG - Intronic
1129153882 15:73705520-73705542 TTGGGGAAGGGGTGGGCAGAAGG - Intronic
1129375276 15:75126360-75126382 CTGGGGTACTAGGGGGCAGGTGG - Intergenic
1129603233 15:77012329-77012351 CTGGTGGACAGGTGGACAAATGG - Intronic
1130064710 15:80594128-80594150 CTGGGGGAATGCTGGGAAAATGG + Exonic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130135283 15:81176925-81176947 CTGAGGGGCTGGGGGGCACAAGG + Intronic
1130379904 15:83362654-83362676 TGGGGTGACTGGAGGGCAGAGGG - Intergenic
1130878458 15:88034071-88034093 CTGGGAGTCTGGTGGCCAGCTGG - Intronic
1130946266 15:88552606-88552628 CGGGGCGGCTGGCGGGCAGAGGG + Intergenic
1131035940 15:89222018-89222040 CTGGGGGAGGGGTGGGCAATAGG - Intergenic
1131838912 15:96416287-96416309 CCGGGGTCCTGTTGGGCAGATGG - Intergenic
1132146577 15:99433071-99433093 CTGGGCAGCTGGAGGGCAGAAGG - Intergenic
1132232240 15:100192869-100192891 CTGGGGGAGTGATGGGGAGGAGG - Intronic
1132626480 16:894060-894082 CAGGGGGACGGGTGGGCGGATGG - Intronic
1132626506 16:894124-894146 ACAGGGGACGGGTGGGCAGACGG - Intronic
1132626517 16:894155-894177 CAGGGGGACGGGTGGGCGGACGG - Intronic
1132626551 16:894251-894273 CAGGGGGACAGGTGGGCGGACGG - Intronic
1132626585 16:894346-894368 CGGGGGGACAGGTGGGCGGACGG - Intronic
1132626616 16:894440-894462 CAGGGGGATGGGTGGGCGGACGG - Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1132997021 16:2828769-2828791 CTGGGGGATGGGTGTGCAGTGGG + Intergenic
1132999243 16:2840872-2840894 CTGGGGTCCTGGGAGGCAGATGG + Intergenic
1133036333 16:3036215-3036237 CTGGGAAACTGGGGGGCTGAGGG - Intronic
1133226257 16:4341877-4341899 CTAGGTGACAGGTGGGCAGCTGG - Intronic
1133789713 16:9000098-9000120 CTGGGGGGGTGGTGGGGAGTTGG + Intergenic
1133921013 16:10153307-10153329 CTTGTGGACTGGTTGGCAGAGGG - Intronic
1134353595 16:13460895-13460917 CTGAGCGGCTGGTTGGCAGAAGG - Intergenic
1134443054 16:14310797-14310819 CCAGGGGGCTGGTGGGCAGCTGG - Intergenic
1135489530 16:22897143-22897165 CTGGGGGACATTTGAGCAGAAGG - Intronic
1135534178 16:23280124-23280146 CTGGCGGAGTGCTGGGCACACGG - Intronic
1135553550 16:23416938-23416960 CTGGGGAACTGGGGACCAGACGG - Intronic
1135719297 16:24801426-24801448 CTGGAGGACTGGTGGACTGAGGG + Intronic
1136120301 16:28128668-28128690 CAGGGGAAGTGCTGGGCAGAGGG - Intronic
1136136376 16:28259089-28259111 CGAGGTGGCTGGTGGGCAGACGG - Intergenic
1136612904 16:31378057-31378079 CTGGAGACCTGGTGGGCAGCTGG - Intronic
1137017897 16:35394531-35394553 CTGTGGGACAGATGGACAGAGGG - Intergenic
1137403347 16:48171171-48171193 CTGGGGGACTGGGGAGGAGGTGG - Intronic
1138028227 16:53539369-53539391 CGGGGCGGCTGCTGGGCAGAGGG - Intergenic
1138086281 16:54136509-54136531 CTGGTGGACTGAAGGGGAGAGGG - Intergenic
1138309297 16:56009499-56009521 CAGGGAGAATGGTGGGCAGTAGG + Intergenic
1138346046 16:56320831-56320853 CTGGGACAGTGGTGGGAAGAGGG + Intronic
1138438489 16:57020381-57020403 CTGGGGGACAGGTGAACTGAGGG - Intronic
1138438525 16:57020493-57020515 CTGGGGGACAGGAGAGCTGAGGG - Intronic
1138510932 16:57508089-57508111 CTGGAGGGCTGGAGTGCAGAGGG + Intergenic
1138587352 16:57979247-57979269 TTGGGTGACAGGTGGGCTGAGGG + Intronic
1138588717 16:57987667-57987689 CTGGAGGACTGGTGGGGGGTTGG + Intronic
1138643612 16:58406538-58406560 CTGGAGGGCTGCTGGGGAGAGGG - Intergenic
1138806786 16:60099867-60099889 CTGGGGCAGTGGTGGCCACAGGG - Intergenic
1140273197 16:73484468-73484490 CTGGGTGCCTGGTGACCAGATGG + Intergenic
1140315797 16:73895491-73895513 TTGGGGGACTGGATGGCTGAGGG - Intergenic
1140747418 16:77993486-77993508 CTACAGGATTGGTGGGCAGATGG - Intergenic
1141480716 16:84304863-84304885 CTGGGCCACAGGAGGGCAGAGGG + Intronic
1141589063 16:85055740-85055762 CTGGGGGAGAGGTGAGAAGAAGG - Intronic
1141629184 16:85277442-85277464 TTGGGCGGCTGGTGGGCACAGGG + Intergenic
1142020779 16:87780883-87780905 GTGAAGGACTTGTGGGCAGAGGG - Intergenic
1142198762 16:88751143-88751165 CTTGGGGACTGAGGGGCAGGTGG - Intronic
1142262104 16:89047905-89047927 TTGGGGGCCTGGTGGGGTGATGG + Intergenic
1142281079 16:89147822-89147844 TTGGGGGACTGTTGGGAAGTAGG - Intronic
1142343394 16:89538402-89538424 CTGGGGGACGGATGGACAGGAGG + Intronic
1142354940 16:89597813-89597835 CGGGGGGATGGGTGGACAGATGG - Intergenic
1142355091 16:89598224-89598246 CGGGGGGATGGGTGGGCGGATGG - Intergenic
1142665401 17:1460358-1460380 GTGGGGGACTGGGAGGCACAAGG + Intronic
1142719469 17:1766744-1766766 CTGGGGGCCTGGAGGGGTGAGGG + Intronic
1143003188 17:3808618-3808640 TTAGGGAACTGGTGAGCAGAGGG + Intergenic
1143537396 17:7549374-7549396 CTGGGGGCCGCGTGGGCTGAAGG + Intronic
1144785826 17:17831048-17831070 CTAGGTGAATGTTGGGCAGAAGG + Intronic
1144798983 17:17912389-17912411 CGGGGCGGCTGCTGGGCAGAGGG + Intronic
1144910605 17:18678322-18678344 GTTGGGTACTGGTGGGTAGATGG + Intronic
1145735989 17:27232021-27232043 CTGGGATACTGTAGGGCAGAAGG + Intergenic
1146001415 17:29132835-29132857 GGGAGGGACTGGTGGACAGAGGG + Intronic
1146596843 17:34176825-34176847 CTGTGGCACTGCTGGGCAAAAGG - Intergenic
1146974096 17:37096317-37096339 CTGGGTGCCTGGTAGGAAGAAGG - Intronic
1147645948 17:42034000-42034022 CTGGGCTACAGCTGGGCAGAAGG + Intronic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1148156514 17:45427861-45427883 CTGGAGGAAGGATGGGCAGAGGG + Intronic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1148805445 17:50261530-50261552 CTTGGTGACTGATGGGCAGAAGG + Intergenic
1148806442 17:50266416-50266438 ATGGGGGAATGGTGAGCAGGGGG - Intergenic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1148869543 17:50648302-50648324 CTCGGGGATTGGAGGGCTGAAGG + Intronic
1150007736 17:61479985-61480007 CTGGGGGTGGGGCGGGCAGATGG + Intronic
1150141494 17:62733548-62733570 CTGGTGGGCTGGTGGGCTGGTGG - Intronic
1150239794 17:63622473-63622495 CTGAGGGACTGGCGGGCGGGCGG + Exonic
1150321325 17:64216868-64216890 CTGGGTGTCAGGTGGCCAGATGG + Intronic
1150388192 17:64776508-64776530 CTGGAGGAAGGATGGGCAGAGGG + Intergenic
1150791261 17:68201443-68201465 CTGGAGGAAGGATGGGCAGAGGG - Intergenic
1151010742 17:70492707-70492729 CTGGGGGACTTGGGGGAAAAGGG + Intergenic
1151375546 17:73686367-73686389 CTGGGGGCCTGTGGGGCAGTGGG - Intergenic
1152050860 17:77975453-77975475 CTGGGCAACTGGTGGAAAGATGG + Intergenic
1152146493 17:78571856-78571878 GTTTGGGATTGGTGGGCAGAAGG - Intronic
1152451938 17:80387094-80387116 TTGGGGGACTGAGGTGCAGATGG - Intronic
1152593955 17:81229245-81229267 CTGGGGGTGGGGTGGGCACAGGG + Exonic
1152641452 17:81451006-81451028 CGGAAGGACTGATGGGCAGATGG + Intronic
1152817200 17:82415023-82415045 CTGGGGCACAGGACGGCAGAAGG + Intronic
1152962905 18:90438-90460 ATAGGGTAATGGTGGGCAGAGGG + Intergenic
1154089621 18:11344789-11344811 CGGGGCGGCTGCTGGGCAGAGGG - Intergenic
1155334888 18:24753493-24753515 CTGGGAGACTTGGGGGCAAAGGG - Intergenic
1156088674 18:33440291-33440313 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156088678 18:33440299-33440321 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156088682 18:33440307-33440329 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156088686 18:33440315-33440337 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156310561 18:35918489-35918511 CTGGGGGTCAGGAGTGCAGAGGG + Intergenic
1157301518 18:46483114-46483136 CTGGGGTACTGTGAGGCAGATGG + Intronic
1157318889 18:46619300-46619322 CTAGGGAACAGGTGGGCAGAGGG - Intronic
1157422903 18:47560898-47560920 CTGGGGGGCTGGCGGGCACTGGG - Intergenic
1157968392 18:52236706-52236728 CTGGTGGAGGGGTGGGCAGGGGG + Intergenic
1158260531 18:55601323-55601345 CTTGGGAAGAGGTGGGCAGATGG - Intronic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1160088960 18:75808114-75808136 CTGGGAGACTGGTGGCAAGGTGG - Intergenic
1160205143 18:76825244-76825266 CAGGAGGACTGGTGTTCAGAAGG - Intronic
1160213604 18:76906418-76906440 CTGGGGAACTCGGGGGCACATGG + Intronic
1160431591 18:78816790-78816812 CTGTCAGCCTGGTGGGCAGAAGG - Intergenic
1160594279 18:79963562-79963584 GTGGGGCACTCGTGGGCAGCAGG + Intergenic
1160719876 19:592364-592386 CTGGGGGGCAGGTGGGCAGATGG + Intronic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1160807560 19:999165-999187 CTTGGGGACTGGTAGACAGCGGG + Intergenic
1161112730 19:2479098-2479120 CTTGGGGGCTGCAGGGCAGAGGG - Intergenic
1161313845 19:3608832-3608854 GTGAGGGGCTGGGGGGCAGATGG + Intergenic
1161355849 19:3819280-3819302 CTTGGGGAGTGCTGGGCAGGCGG + Intronic
1161790191 19:6355499-6355521 CGGGGTGGCTGCTGGGCAGAGGG - Intergenic
1161849890 19:6732812-6732834 CCGCAGGACTGGTGGACAGAGGG + Intronic
1161951805 19:7471674-7471696 CTCGGGGACAGATGGGCACAAGG + Exonic
1162315791 19:9937106-9937128 CGGGAGGACTGGTGGGGAAATGG - Intergenic
1162807450 19:13145358-13145380 CTGGGTGACTTCTGGGCAGCTGG + Exonic
1162830011 19:13278544-13278566 CCGGGGGTGTGGTGGGCAGAGGG - Intronic
1163167648 19:15508758-15508780 CCGGGGCACTCGTGGGGAGAGGG + Intronic
1163218356 19:15897139-15897161 CTGCGGGGCTCCTGGGCAGAGGG - Intronic
1163556703 19:17997404-17997426 CTGGGGGTCTAGTGGCCACAGGG - Intronic
1163675719 19:18654369-18654391 CAGGTGGATGGGTGGGCAGATGG - Intronic
1163828326 19:19535913-19535935 CTGGGCCAGGGGTGGGCAGAGGG - Exonic
1164907240 19:31977437-31977459 ATGGGGCAGTGGTGGTCAGAGGG - Intergenic
1165018058 19:32898401-32898423 GTGGGGGGCTGGGGGGCAGGTGG + Intronic
1165095004 19:33405499-33405521 CTGGGGGATTGCTGAGCAGCAGG + Intronic
1165148838 19:33749441-33749463 GTGGGGGGATGGTGGGGAGATGG - Intronic
1165364998 19:35359892-35359914 CTGTGGAACTGGTGGCCAGGTGG + Exonic
1165366817 19:35372361-35372383 CTGTGGAACTGGTGGCCAGGTGG + Exonic
1165420794 19:35721050-35721072 CTGGGGAACAGGTGGGGAGGTGG - Exonic
1165449611 19:35874481-35874503 CTGGGGAGCGGGTGGGCACAGGG - Intronic
1165763349 19:38335656-38335678 CGCGGGGCCTGGTCGGCAGAGGG - Intergenic
1165766741 19:38356383-38356405 CGGAGGGGCTGGTGGGCATAAGG + Intronic
1165838860 19:38774900-38774922 CTGGGGGCCTGGGACGCAGAGGG - Intergenic
1166076171 19:40414940-40414962 ATGGGGGACAGGTCTGCAGAGGG - Intergenic
1166191609 19:41180304-41180326 CTGGGTGGCTGCCGGGCAGAGGG - Intergenic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166299487 19:41905972-41905994 CTCGGGGCCTGGTCTGCAGAAGG - Exonic
1166305138 19:41933043-41933065 CTGCAGAATTGGTGGGCAGATGG + Intergenic
1166529693 19:43535006-43535028 CTGGGGGACAGGAGGGCTGGTGG - Intronic
1166756035 19:45192186-45192208 CTGGGGCAGTGGTGGCCACAGGG - Intronic
1166993083 19:46704869-46704891 CTGGGGGACAGATGGGGTGATGG - Intronic
1166993113 19:46704988-46705010 CTGGGGGACAGATGGGGTGATGG - Intronic
1167042071 19:47028285-47028307 CTGGGGGGCTGGGGGGTTGACGG - Intronic
1167101897 19:47408825-47408847 CTGGGTGGATGGTGGGCAGGTGG + Intronic
1167293272 19:48635875-48635897 CTGGGGCAGTGGTGGGCGGAGGG - Exonic
1167400232 19:49261669-49261691 CTAGGGGGGTGCTGGGCAGAGGG + Intergenic
1168181642 19:54665944-54665966 TTGGGGGACCCGTGGGCTGATGG + Intronic
1168358563 19:55718646-55718668 CTGGGCAACAGGTGGGGAGAGGG - Intronic
1168449775 19:56457337-56457359 CAGGGGGACAGGTGGGCATAAGG + Intronic
925038252 2:708837-708859 CTGGGGGATTTGAGGGGAGACGG + Intergenic
925146822 2:1587732-1587754 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925146883 2:1587941-1587963 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925167590 2:1727682-1727704 CAGGGGGTCTGGTGGGCAGGGGG - Intronic
925358243 2:3258009-3258031 CTGGAGCCCTGGTGGGCAGCAGG + Intronic
925745278 2:7038744-7038766 CTGGTGAATTGATGGGCAGATGG + Intronic
926683090 2:15678661-15678683 CTGGGGGGCTGGGGGGCTGGAGG + Intergenic
927594556 2:24385291-24385313 CTGGAGGGTTGGTGGGCAGAGGG - Intergenic
928615435 2:33034001-33034023 CTGGGGGACAGGAGAGCAGATGG + Intronic
928622809 2:33108221-33108243 CTGGGGGGCTGTGGGGCAGAGGG + Intronic
929018334 2:37524666-37524688 GTGGGGGACAGGTGGAAAGATGG + Intergenic
929217019 2:39425100-39425122 CTGGGGGGGTGGTGGGGAGTGGG - Intronic
929668619 2:43852487-43852509 GTGAGGGCCTGGGGGGCAGATGG + Intronic
930542515 2:52724678-52724700 CAAGGGGATTAGTGGGCAGAAGG - Intergenic
930720051 2:54629837-54629859 CTGGGCCACTGGTGGTCACAAGG - Intronic
931995060 2:67831806-67831828 TTGGGAGACAGGTGGGAAGATGG - Intergenic
932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG + Intergenic
932606550 2:73169503-73169525 CAGGAGGTCTGGTGGGGAGAGGG + Intergenic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
932708897 2:74047773-74047795 CTGTCGGACAGGTGGGAAGAGGG - Exonic
932807525 2:74796193-74796215 CGGGGTGGCTGCTGGGCAGAGGG + Intergenic
933925876 2:87090932-87090954 CAGGAGGTCTGGTGGGGAGAGGG - Intergenic
933994063 2:87655059-87655081 CTGTGTGACTGGTGGGATGAAGG + Intergenic
934040680 2:88125508-88125530 CTGTGTGAGTGGTTGGCAGATGG - Intronic
934171571 2:89544714-89544736 CTGAGGGACTGGATGGGAGAGGG + Intergenic
934653020 2:96103205-96103227 CTGGGGAACTGGTGTGCCCAGGG + Intergenic
934884700 2:98014413-98014435 CTGGTGGACTGGTGGGCTGGTGG - Intergenic
934884748 2:98014565-98014587 CTGGTGGGCTGGTGGGCCGGTGG - Intergenic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
935101326 2:99998482-99998504 ATGGGGGAGAGGTGGGCAGAGGG + Intronic
935691983 2:105740397-105740419 CAGGGGAACTGGAGAGCAGAAGG + Intergenic
936299801 2:111295851-111295873 CTGTGTGACTGGTGGGATGAAGG - Intergenic
937257241 2:120564275-120564297 CTGGGGGCGAGGCGGGCAGAGGG + Intergenic
938131590 2:128720238-128720260 TTGGGGGACTGGAAAGCAGATGG + Intergenic
938195575 2:129324541-129324563 ACGGGAGACTGGTGGGCAGGAGG + Intergenic
938727936 2:134123161-134123183 TTGGAGGACAGCTGGGCAGAAGG - Intronic
939785756 2:146509751-146509773 CTGGGGTGCTGGTGGGGTGATGG - Intergenic
941318177 2:164020670-164020692 CTGGTGGGCTGGTGGGCTGGTGG + Intergenic
941724643 2:168848261-168848283 CTGGGAGACAGAAGGGCAGACGG + Intronic
941786617 2:169505710-169505732 CGGGGCGGCTGCTGGGCAGAGGG - Exonic
941786627 2:169505750-169505772 CAGGGTGGCTGCTGGGCAGAGGG - Exonic
943411726 2:187556692-187556714 CAGGGTGGCTGCTGGGCAGAGGG - Intronic
944333939 2:198506417-198506439 GTGGGGGACTGGAGGGGAGGTGG + Intronic
945316663 2:208377616-208377638 CAGGGTGGCTGCTGGGCAGAGGG + Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946382428 2:219358323-219358345 CAGGGTGCCTGGTGGGCAGAGGG - Intergenic
946432904 2:219635051-219635073 CTGGGGGAATGGAGGGCACCTGG + Intronic
946434457 2:219642535-219642557 CTGGGGGACTTGAGGGGAGCGGG + Intergenic
946902286 2:224384145-224384167 CTGTGGGACTGGGTGACAGAGGG - Intronic
946999236 2:225434235-225434257 CTGCTGTACTGGAGGGCAGAGGG - Intronic
947212695 2:227722436-227722458 ATGGGGTAATGGTGGGGAGAGGG + Intergenic
947281427 2:228460071-228460093 GTGGGGCACTGGTGGGCACAGGG + Intergenic
948429378 2:237909451-237909473 CTTGGGGACTGATGGCCTGAAGG - Intronic
948792161 2:240384702-240384724 CTGGGGTACTGGTTGGCACAGGG - Intergenic
948863579 2:240764385-240764407 CTGGGCGACAGCTGGTCAGACGG - Intronic
949075760 2:242056763-242056785 CAGGGGGACTGGAGGGCCGTGGG + Intergenic
1169087440 20:2836130-2836152 CTGGGGCAGGGGTGGGAAGAGGG + Exonic
1169109603 20:3023650-3023672 ATAGGGTAATGGTGGGCAGAGGG - Intronic
1169195781 20:3681459-3681481 CTGGGGGACTCTTGGGCATGGGG + Intronic
1170645238 20:18191740-18191762 CTGGGGGTGAGGTGGGGAGAGGG + Intergenic
1171177322 20:23062309-23062331 CTGGTGGACTGAAGGGCAGCTGG + Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171291657 20:23986032-23986054 GTGGGGGACTGGGGTGGAGAGGG - Intronic
1171424909 20:25043144-25043166 GTGGGGGACTGGTGAGGACATGG - Intronic
1172007679 20:31828752-31828774 CCAGGGGACTGTTGGGAAGATGG - Intronic
1172527280 20:35607532-35607554 TGGGCGGGCTGGTGGGCAGAAGG - Intergenic
1172669798 20:36627145-36627167 CAGAGTGGCTGGTGGGCAGAGGG + Intronic
1172865118 20:38089968-38089990 CTGGGGGGCTGGGCGGAAGAAGG - Exonic
1172946447 20:38693177-38693199 CTGGGGGCCTGCTGGGAGGAGGG - Intergenic
1173229802 20:41185333-41185355 GTGGGGGAGTGGGTGGCAGAAGG - Intronic
1173849642 20:46209940-46209962 CTGGGGGAGTCCTGGGCACAGGG + Intronic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1174412212 20:50343584-50343606 CAGGGTCCCTGGTGGGCAGATGG + Intergenic
1174433847 20:50491255-50491277 ATGGGGGAGGGGTGGGGAGAGGG - Intergenic
1174658303 20:52190542-52190564 CTGGGGGACTGGCGGGGAGGGGG - Intronic
1175385380 20:58591655-58591677 CTGGGGGTCTGGAGGGCTGCAGG - Intergenic
1175392762 20:58637505-58637527 CTTGGGAAGGGGTGGGCAGAAGG - Intergenic
1175834194 20:61982885-61982907 GTGGGGGACGGGTGGGGAGGGGG - Intronic
1176041861 20:63069937-63069959 CCTGGGGACTGGCGGGCACAGGG - Intergenic
1176047625 20:63100970-63100992 CTGGGGGACGGGGAGGGAGATGG + Intergenic
1176121458 20:63456094-63456116 GTGGGGGGCCCGTGGGCAGAGGG - Intronic
1176121474 20:63456128-63456150 GTGGGGGGCCTGTGGGCAGAGGG - Intronic
1176664831 21:9675971-9675993 CTGGGGGACCGGTGGCCGGAGGG - Intergenic
1176704367 21:10101049-10101071 CTGGTGGACCTGTGGGAAGAGGG - Intergenic
1176767969 21:13038528-13038550 GTGGAGGAGTGGTGGGCAGCGGG + Intergenic
1178286252 21:31327933-31327955 CTGCGGGACTGCTGGTGAGATGG - Intronic
1178730183 21:35094830-35094852 GTAGGGGTCAGGTGGGCAGAGGG - Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1180042707 21:45288255-45288277 CTGGGGGCCGGGAGGGCTGACGG + Intergenic
1180515101 22:16132790-16132812 GTGGAGGAGTGGTGGGCAGCGGG + Intergenic
1180765741 22:18345061-18345083 GTGGGGGACTGGGGTGGAGAGGG + Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180780569 22:18517317-18517339 GTGGGGGACTGGGGTGGAGAGGG - Intronic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180813288 22:18774638-18774660 GTGGGGGACTGGGGTGGAGAGGG - Intergenic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181199463 22:21208954-21208976 GTGGGGGACTGGGGTGGAGAGGG - Intronic
1181281921 22:21726561-21726583 CTGGAACACTGGTGGTCAGAGGG - Intronic
1181400293 22:22646903-22646925 ATGGGGGACTGGGGTGGAGAGGG + Intronic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181648136 22:24244747-24244769 AGGGGCGGCTGGTGGGCAGACGG + Exonic
1181649069 22:24248888-24248910 GTGGGGGACTGGGGTGGAGAGGG - Intergenic
1181669900 22:24421153-24421175 CTGTGGGACTGGGGTGCACATGG + Intronic
1181702271 22:24628001-24628023 GTGGGGGACTGGGGTGGAGAGGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181751099 22:24989732-24989754 CTTGGGGAGTGGTGGGGAAAGGG - Intronic
1181792327 22:25277868-25277890 CGGGGCGGCTGCTGGGCAGAGGG + Intergenic
1182043879 22:27259442-27259464 CTGGGGGAGCGATGGGCAGGAGG - Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182114155 22:27745402-27745424 CTGGGGGAACGAGGGGCAGAAGG - Intergenic
1182166309 22:28177847-28177869 TTGGGGGAGTGGAGGACAGATGG + Intronic
1182316283 22:29449448-29449470 CCAGGGGATTGGTGGGCAGGCGG + Intergenic
1182457299 22:30460143-30460165 CTGGGGGACAGATGGAAAGAGGG + Intronic
1182512751 22:30830633-30830655 CTGGGGGACAGGTGAGGAGTGGG - Intronic
1182861989 22:33568262-33568284 CCGGGAGACTGGTGGGCAGGAGG - Intronic
1182892423 22:33830066-33830088 CTTGTTGACTGGTGGGCACATGG - Intronic
1183741205 22:39669593-39669615 CTGGCTGGCTGGTGGGTAGATGG + Intronic
1184120104 22:42444530-42444552 CTGAGGGATTGGTGGGGAGGGGG + Intergenic
1184191392 22:42897652-42897674 CTGAGGGACTGCCTGGCAGACGG + Intronic
1184392525 22:44212694-44212716 CTTGGGCAGTGGTGAGCAGAGGG + Intronic
1184445234 22:44543200-44543222 GTGGGGTCCAGGTGGGCAGAGGG - Intergenic
1184784819 22:46666599-46666621 CTGGGGCCCTTCTGGGCAGAGGG - Intronic
1185108780 22:48889340-48889362 CGGGGGCACTGGAGGGGAGAGGG - Intergenic
1203227363 22_KI270731v1_random:85952-85974 GTGGGGGACTGGGGTGGAGAGGG + Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1203263390 22_KI270734v1_random:320-342 GTGGGGGACTGGGGTGGAGAGGG - Intergenic
949281558 3:2352778-2352800 GTGCGGGACTGGTGGGCAGCAGG + Intronic
949531949 3:4964887-4964909 CTGTGGGACAGGTGAGAAGAAGG + Intergenic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
950113548 3:10435643-10435665 CAGGGTGACAGGTGGGCAGGAGG + Intronic
950183866 3:10933282-10933304 CTGGGTACCTGGTGGGCAGCTGG - Intronic
950533600 3:13567109-13567131 CTGGGGGCCTGGGGGGCCAAGGG + Intronic
951180645 3:19654742-19654764 CTGGTGGAGTGGTGAGAAGAGGG - Intergenic
953132248 3:40151216-40151238 TTGGTGGGCTGGTGGGTAGAAGG + Intronic
953190117 3:40677950-40677972 AAGGTGCACTGGTGGGCAGACGG - Intergenic
954374902 3:50188966-50188988 CTGGGGGGCAGTTGGGTAGATGG + Exonic
954599790 3:51858784-51858806 CGGGGTGGCTGCTGGGCAGAGGG - Intergenic
954611263 3:51945690-51945712 CTCGAGGGCAGGTGGGCAGAGGG - Intronic
954708800 3:52494998-52495020 CTGGGGTGCTGGTCGGCGGAAGG - Intergenic
955339260 3:58112333-58112355 CTGGGGGCCAGGGGAGCAGAGGG - Intronic
955598695 3:60620885-60620907 CTGGGGGAGTGGTGGGGCGTAGG + Intronic
955674433 3:61434624-61434646 CGGGGCGGCTGGCGGGCAGAGGG + Intergenic
956062051 3:65357510-65357532 GTGGGAGACGGGTGGGCACAGGG - Intronic
956644785 3:71444891-71444913 CATGGGGACTGGAGGGTAGAGGG + Intronic
957590185 3:82186420-82186442 CTGAGGCATTGGTGGACAGACGG - Intergenic
957914613 3:86672219-86672241 CTGGGGGACTGGGGGAAAGGAGG - Intergenic
959419195 3:106111458-106111480 CGGGGCGGCTGGCGGGCAGAGGG + Intergenic
959806560 3:110561845-110561867 CTGGGGCATTGGTGGCCACAGGG - Intergenic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
960065932 3:113372575-113372597 GTTGGGGAGTGGGGGGCAGAGGG + Intronic
960944822 3:122958668-122958690 CTGGGGGACTGGGGCCCAGAGGG + Intronic
961214170 3:125146923-125146945 ATTGGTGACTGGTGGTCAGATGG - Intronic
961324711 3:126103334-126103356 CTGGGAAACAGGTGGGAAGACGG - Intergenic
961369987 3:126423191-126423213 CTGGGTAACTTGTGGGCAGCTGG + Intronic
961511517 3:127406644-127406666 GTGGGGGAATGTTGGGCAGAGGG + Intergenic
962184658 3:133245306-133245328 CTGGAGTACTGCTGTGCAGAGGG - Intronic
963069257 3:141289382-141289404 CTGGGGGGCTGGTCTCCAGAAGG - Intronic
964131962 3:153299266-153299288 GTGGGGGGCTGGTGGGAGGAGGG + Intergenic
965900776 3:173639030-173639052 CTGAAGGACTGGTGAGCATAGGG + Intronic
966852504 3:184172762-184172784 CTGGGGTTTTGGTGTGCAGAGGG + Exonic
966910846 3:184559203-184559225 TTTGGGGATAGGTGGGCAGAAGG - Intronic
968156534 3:196385678-196385700 CGGGGCGGCTGCTGGGCAGAGGG - Intronic
968156876 3:196388297-196388319 CTGGGGGGCTGGGGGGCTGGGGG + Intronic
968286897 3:197514097-197514119 CTGGGGTGATGGTGGGCAGAGGG - Intronic
968515273 4:1013029-1013051 CTGGGGGACTGGGGGTCTGGGGG - Intronic
968520015 4:1030972-1030994 CTGGGGGACAGGGGAGCAGCAGG - Intergenic
968966466 4:3771421-3771443 GTGGTGGACAGGTCGGCAGAGGG - Intergenic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
969652777 4:8477765-8477787 CTGCAGGACTGGGGGGCCGAGGG - Intronic
970736570 4:19176994-19177016 CTAGGGGAAATGTGGGCAGAGGG - Intergenic
972333571 4:38085509-38085531 CTGGGGGACTGGAACCCAGAAGG + Intronic
972953876 4:44365159-44365181 CAGGGAGAGTGGTGGGCATATGG + Intronic
973263367 4:48186607-48186629 CGGGGCGGCTGCTGGGCAGAGGG - Intronic
973650477 4:52992861-52992883 CGGGGTGACTGCTGGGCAGAGGG - Intronic
975572057 4:75827902-75827924 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
980376579 4:131957383-131957405 CTGGTGGACCTGTGGGAAGAGGG - Intergenic
981093754 4:140758157-140758179 GTGGGAGACAGGAGGGCAGAAGG - Intergenic
982104513 4:151999851-151999873 TTGGGGGAGTGGTGGGGACATGG + Intergenic
982108088 4:152028768-152028790 CTGGAAGGCTGGTGGGAAGAAGG + Intergenic
982208868 4:153019106-153019128 CTGGGGGACTAAAAGGCAGAGGG + Intergenic
983017285 4:162628729-162628751 CTGGGGTGGTGGTGGTCAGAGGG + Intergenic
984115205 4:175671622-175671644 GTGGAGGAATGGTTGGCAGAGGG + Intronic
984702074 4:182825064-182825086 CTGGGGGCCAGGGTGGCAGAGGG - Intergenic
984704004 4:182834634-182834656 CTGGGGGACAGGAGAGGAGAAGG - Intergenic
984709290 4:182871767-182871789 CTGGGGAAGTGGTGGGGAGGTGG - Intergenic
985410308 4:189676612-189676634 CTGGGGGACCGGTGGCCCGAGGG - Intergenic
985574162 5:665878-665900 CTGGGGGAGGGGTGGTCAGGAGG - Intronic
985586452 5:740122-740144 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985601040 5:832299-832321 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985640792 5:1062673-1062695 CTGGGGGGCTGGGGGGCTGGGGG + Intronic
985640794 5:1062681-1062703 CTGGGGGGCTGGGGGACTGAGGG + Intronic
985640805 5:1062705-1062727 CTGGGGGACTGGGGGGCTGCGGG + Intronic
985669692 5:1201039-1201061 CGTGGGGACTGGTGGGAAGCCGG + Intergenic
985711984 5:1434503-1434525 CAGCCTGACTGGTGGGCAGATGG + Intronic
986081102 5:4394991-4395013 CTAGGGGAGTGGAGTGCAGAAGG - Intergenic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
986350834 5:6878142-6878164 GTGAGTGCCTGGTGGGCAGAGGG + Intergenic
986650253 5:9956332-9956354 GTGGCTGACTTGTGGGCAGATGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987237941 5:15962094-15962116 CTGGAGGAGAGGTGGACAGATGG - Intergenic
988376280 5:30439666-30439688 CTGGGGCAGTGGTGGCCACAGGG + Intergenic
988609792 5:32713280-32713302 TTGGGGGACAGGTGGAAAGAAGG - Intronic
988991180 5:36672409-36672431 GTGGGGGAATGCTGAGCAGATGG - Intronic
989995708 5:50827976-50827998 CTGGTGGACTGCTGAGAAGAAGG - Exonic
990774261 5:59287291-59287313 CTGGGGCAGTGGTGGCCACAGGG + Intronic
991125705 5:63067493-63067515 CTGGGGGACTGAAAGGGAGAGGG - Intergenic
992111616 5:73498937-73498959 GTGGGGGAGTGGTGGGGAGGCGG + Intronic
992244847 5:74810324-74810346 CCGGGGGACTGGTGCACAAAGGG + Intronic
992733233 5:79692784-79692806 ATGGATGAATGGTGGGCAGAAGG - Intronic
994074872 5:95639447-95639469 CTGGGGGACGGGTGGGCAGAAGG + Intergenic
994451538 5:99950457-99950479 GAGGGGGACTGGGGGGCTGAGGG + Intergenic
994659392 5:102635384-102635406 CTGGGTGACAGGGTGGCAGAGGG + Intergenic
994985357 5:106926526-106926548 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995769231 5:115651758-115651780 ATGGGGGAATGGAGGGCGGAAGG - Intergenic
997754013 5:136377593-136377615 GTGGGAGATTGGTGGGCAGAAGG + Intronic
997890402 5:137671424-137671446 CTCATAGACTGGTGGGCAGACGG - Intronic
998040884 5:138950429-138950451 CTGGGGGAGGCGTGTGCAGAGGG + Intronic
998205272 5:140153180-140153202 CTGGGGGAGGGGTGAGGAGATGG - Intergenic
999217041 5:149944126-149944148 CTGGGGTACAGGTGGGGTGAGGG - Intronic
999362755 5:150999623-150999645 CAGGGGAACAGGTGAGCAGATGG - Intergenic
999767908 5:154755224-154755246 CTGGGCGACGGGCGGGCAGGAGG - Intronic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1001001449 5:168011221-168011243 CTGTGGGAATGATGTGCAGATGG + Intronic
1001429068 5:171645357-171645379 TTGGGTGGCTGGTGGGGAGAAGG - Intergenic
1001481803 5:172093783-172093805 CTGGGGGACTGGTGGTTTGGAGG + Exonic
1001581728 5:172803135-172803157 CTGGAGCACTGTTGGGAAGAGGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002053377 5:176584526-176584548 CTGGGGGCTGGGTGGGCTGAGGG + Exonic
1002203144 5:177543028-177543050 CTGGAGGTCAGGTGGACAGATGG - Intronic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002312944 5:178325632-178325654 CAATGGGACTGATGGGCAGACGG - Intronic
1002334214 5:178466828-178466850 CTGGGGGTCAGCTGGGCACACGG + Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1003568952 6:7243409-7243431 CCGAGGGACTGATGGGGAGAGGG + Intronic
1003675631 6:8202112-8202134 TGGGGGTGCTGGTGGGCAGAAGG - Intergenic
1004874595 6:19940098-19940120 CGGGGTGGCTGGTGGGCGGAGGG - Intergenic
1005957914 6:30677336-30677358 GGGGGGGAAGGGTGGGCAGAAGG - Intronic
1005997557 6:30940683-30940705 CTGGGGAAGTGGGGAGCAGATGG - Intergenic
1006082671 6:31576519-31576541 CTGGGGAACTGTTGGGGAGAAGG - Exonic
1006408387 6:33857983-33858005 CTGGAGCACTGGTGGGCACTGGG + Intergenic
1006448070 6:34091002-34091024 CTGGGGGGCTGTGGGGCTGAAGG - Intronic
1006449783 6:34099276-34099298 CAGGGGTACAGGTGGTCAGATGG + Intronic
1006522531 6:34579661-34579683 CTAGGGCACTGCTGGGCACAAGG + Intergenic
1006582130 6:35083255-35083277 CTGTGGGACTGGCCAGCAGAAGG + Intronic
1006884600 6:37370620-37370642 CTCAGGGCTTGGTGGGCAGAGGG - Intronic
1007104256 6:39272679-39272701 CTTGGAGACTGATGGGCTGAGGG + Intergenic
1008304550 6:49885923-49885945 CTGGGGCACTAGTGGACACAGGG - Intergenic
1008409268 6:51154296-51154318 TTGGGGGAAGGGTGGGAAGAGGG - Intergenic
1008427905 6:51380678-51380700 GTGTGGGACTGGTGGACAGAAGG + Intergenic
1009042048 6:58190825-58190847 CGGGGCGGCTGCTGGGCAGAGGG - Intergenic
1010270884 6:73914981-73915003 CGGGGTGGCTGCTGGGCAGAGGG + Intergenic
1011363646 6:86555392-86555414 AAAGGGGACTGGTGGGCAGATGG + Intergenic
1011885557 6:92090628-92090650 CTGGGGCAAGGGTGGCCAGAAGG - Intergenic
1012827403 6:104163219-104163241 CTGGGGCATTGGTGGCCACAGGG + Intergenic
1012830220 6:104195273-104195295 GTGGGGCACTAGTGGGCACAGGG - Intergenic
1012968138 6:105697592-105697614 TAGGGGGAGGGGTGGGCAGAGGG + Intergenic
1013555193 6:111249768-111249790 CTGGTGGGCAGGTGTGCAGATGG + Intergenic
1015546324 6:134365337-134365359 CTGGGGGATTGATGGGGAGATGG + Intergenic
1016123571 6:140373749-140373771 CAGGGTGGCTGCTGGGCAGAGGG + Intergenic
1016631093 6:146232659-146232681 TTGGGGGGCTGGAGGGCAGGTGG - Intronic
1016895764 6:149050964-149050986 CAGGGAGACTGCTGGGCAGGTGG + Intronic
1017117753 6:150995153-150995175 ATGGGGGAGGGGTGGGGAGATGG + Intronic
1017196705 6:151709130-151709152 CTGGGGCAGTGTCGGGCAGAGGG - Intronic
1017712190 6:157180920-157180942 GTGGGGCATGGGTGGGCAGAGGG - Intronic
1017739955 6:157398023-157398045 CTGGGGAGCTGGGGGGCTGAGGG - Intronic
1018273155 6:162102182-162102204 CTGGGGGATGGGTGGGGGGACGG - Intronic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018812510 6:167308132-167308154 CTGAGGGAATGGTGCCCAGAAGG - Intronic
1018840717 6:167514375-167514397 CTGGGGGACTGGGGGCCTGGGGG + Intergenic
1018840741 6:167514438-167514460 CTGGGGGACTGGGGGCCTGGAGG + Intergenic
1018840760 6:167514478-167514500 CTGGGGGACTGGGGGTCTGGGGG + Intergenic
1018988824 6:168658086-168658108 CTGGGGGACTGATGGGGAGATGG + Intronic
1019173758 6:170149381-170149403 CTGGAGGGGTGGTGGGCAGCTGG - Intergenic
1019173847 6:170149846-170149868 CTGGAGGGGTGGTGGGCAGCTGG - Intergenic
1019191692 6:170254871-170254893 CTGTGGGCCTGGTGGGCACCAGG + Intergenic
1019559925 7:1650922-1650944 CTGGGGGAGGGGTGGGCAAGTGG - Intergenic
1019575621 7:1736288-1736310 CAGGGGGAAAGGTGGGCGGAGGG - Intronic
1019645019 7:2124430-2124452 CTGGGAGATGAGTGGGCAGAAGG + Intronic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1019651542 7:2161857-2161879 CAGGGCGGCTGCTGGGCAGAGGG - Intronic
1019723355 7:2586903-2586925 CTGTGGGAGTGTTAGGCAGAGGG + Intronic
1019803670 7:3106789-3106811 CTTGTGGTCTGGTGGGGAGATGG - Intergenic
1020013581 7:4818791-4818813 GCGGGGCACTGGTGGGAAGAGGG + Intronic
1020035277 7:4959942-4959964 GTGGGGGGTTGGTGGGAAGAAGG + Intergenic
1020098597 7:5382036-5382058 CTGGGGCCCTGCTGGGCACAGGG - Intronic
1020800203 7:12723689-12723711 CTGAGTGGCTGATGGGCAGAAGG - Intergenic
1021174667 7:17437428-17437450 GTGGGGAATTGGAGGGCAGAAGG + Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022417366 7:30189777-30189799 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
1022510287 7:30930971-30930993 CTGGGGGTCTGGTGGGAGGCTGG + Intergenic
1022560087 7:31338608-31338630 CTGGGGGAGTGGTGAGCTCAGGG + Exonic
1023255880 7:38311632-38311654 GTGGGGGTCTGCTGGGCAGCAGG - Intergenic
1023699373 7:42877616-42877638 GAGGGGGACTGGTGGGCAGAGGG - Intergenic
1023780416 7:43650189-43650211 CTGGGACAGGGGTGGGCAGATGG + Exonic
1023864924 7:44234025-44234047 GTGGGGTCCTGGTGGGGAGAGGG + Intronic
1023872192 7:44269215-44269237 CTGGGGGCCTGGTGGGGGCAGGG + Intronic
1024548590 7:50541958-50541980 CTTGGGGAGTGGTGGAGAGAGGG + Intronic
1024804147 7:53116775-53116797 CTGGGGGAGAGGAGGGCATATGG + Intergenic
1025297762 7:57789769-57789791 ATGGAAGACTGGTGGGGAGAGGG + Intergenic
1026101867 7:67390380-67390402 CTGGGAGAGTTGTGGGGAGAGGG + Intergenic
1026221306 7:68399923-68399945 CATGGAGACTGGTGGACAGAGGG - Intergenic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026447525 7:70498575-70498597 GTGGGGGGTTGGTGGGCAGAAGG + Intronic
1026828862 7:73599797-73599819 CATGGGGACTGGCGGGCAGAGGG + Intronic
1027345826 7:77258343-77258365 TTGAGGGATGGGTGGGCAGACGG + Intronic
1028057332 7:86262538-86262560 CTGGGGGCTAGGTGGGCAGTGGG - Intergenic
1029201430 7:98841863-98841885 CGGGGGGCATGGCGGGCAGAGGG - Intergenic
1029269832 7:99370491-99370513 CTGTGGGACGGGTGGGCAGGTGG + Intronic
1029541677 7:101186814-101186836 CTGGGGGACAGAGGGACAGAGGG - Intergenic
1029599179 7:101553779-101553801 CTGGGGGACTGAAGGGGACAGGG + Intronic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1032490107 7:132318141-132318163 CAGGGGGACTGGAGCGGAGAGGG + Intronic
1032623151 7:133558860-133558882 CTGGAGGATAGGTGGGCACAGGG - Intronic
1032854361 7:135822179-135822201 GTGGGGGACAGGTTGGGAGAGGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034944174 7:155251208-155251230 CTGGGGCACTGGAAGGCAGATGG + Intergenic
1034951449 7:155299054-155299076 CTGGGGAACTGGTGAGCAGCGGG + Intronic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035271655 7:157723371-157723393 GTGGGGGACAGGTGGCCAGCCGG - Intronic
1035470994 7:159108623-159108645 CTGGGCGCCTGGTGCCCAGATGG + Intronic
1035906185 8:3512516-3512538 CTGGTGGGCTGGTGGGCTGGTGG + Intronic
1036507011 8:9365236-9365258 CGGGGTGGCTGCTGGGCAGAGGG + Intergenic
1036627422 8:10483454-10483476 TTTGTGAACTGGTGGGCAGAGGG - Intergenic
1036783008 8:11662916-11662938 CTGGGGGCCTTGTGGGCTGGGGG - Intergenic
1036793143 8:11736615-11736637 CTGGAGGAGTGGTGGGCAGAAGG + Intronic
1037270184 8:17118551-17118573 CTGGGGGACTGGGGAGGAAAGGG - Intronic
1037947990 8:23001085-23001107 CTGGGAGAGCGGTGGGCAGGAGG + Intronic
1038331895 8:26615611-26615633 CAGGGGGACTGGTATACAGAAGG - Intronic
1039419045 8:37420352-37420374 CGGGGGGACTGCGGGGCATATGG - Intergenic
1039588094 8:38723712-38723734 CTGGGGGCGTGGGGAGCAGAGGG - Intergenic
1039895379 8:41713308-41713330 CCGCGGGACTGGTGGCCAGCGGG - Intronic
1040043507 8:42939686-42939708 CTGGGTGGCTGCTGGGCGGAGGG + Intronic
1040546763 8:48404053-48404075 CTACGGGCCTGGAGGGCAGAGGG - Intergenic
1040914190 8:52552396-52552418 CTGGGGGACTGGGGTGGGGAAGG - Intronic
1041606971 8:59793089-59793111 CTGGGGCAGTGGTGGCCACATGG + Intergenic
1042874761 8:73431042-73431064 CTTGGGGAGTTGTGGGAAGAAGG + Intronic
1043162358 8:76861917-76861939 ATGGAGGTCTGGTGGGCGGAAGG - Intronic
1043520971 8:81044907-81044929 CGGGGAGACTGGTGGGGAGGGGG - Intronic
1043555045 8:81420956-81420978 CTGTGGGACATGGGGGCAGAGGG + Intergenic
1045065108 8:98437419-98437441 CCCAGGGACTGCTGGGCAGATGG - Intronic
1045140949 8:99281588-99281610 CTGTGAGACTTGTGGGCAAAGGG + Intronic
1045377592 8:101590615-101590637 CTCGGGGCTTGGTGGGAAGAGGG + Intronic
1045959138 8:107946504-107946526 CTGTGGGACTGGGGCACAGAAGG + Intronic
1046454538 8:114440901-114440923 GGGAGGGGCTGGTGGGCAGAAGG - Intergenic
1047338053 8:123955001-123955023 CTGGGGGACTGCTGAGAACAGGG - Intronic
1047388600 8:124432073-124432095 CGGGGCGGCTGCTGGGCAGAGGG + Intergenic
1047588112 8:126296797-126296819 ATGGGGGAGTGGTGGGGTGAGGG - Intergenic
1047687611 8:127317222-127317244 CGGGGCGGCTGGCGGGCAGAGGG - Intergenic
1049253278 8:141600718-141600740 CTGGGGCACAGGTGGGGAAAAGG + Intergenic
1049357271 8:142195135-142195157 CTTGGGGACAGCTGGGGAGAGGG - Intergenic
1049448185 8:142641250-142641272 CTTGGGGAAAGGTGGGCAGGTGG + Intergenic
1049471196 8:142775752-142775774 CTGGGGGCCTGATGGGCTGGAGG - Intronic
1049850078 8:144826328-144826350 CTGGGGGTCTGGAGGGCGGCTGG + Intergenic
1051726185 9:20089692-20089714 CTGTGGCAGTGGTGGGCAGGGGG - Intergenic
1051919090 9:22243201-22243223 CTGGAGGTCTGGGCGGCAGATGG + Intergenic
1052853544 9:33392877-33392899 CTGGAGGACTTGTGTGAAGAAGG - Intronic
1053010671 9:34631042-34631064 CTGGAAGACTGGAGAGCAGAGGG + Intergenic
1053641628 9:40088065-40088087 CTGGTGGACCTGTGGGAAGAGGG - Intergenic
1053764507 9:41377399-41377421 CTGGTGGACCTGTGGGAAGAGGG + Intergenic
1053795847 9:41726262-41726284 ATGGAAGACTGGTGGGGAGAGGG - Intergenic
1054184254 9:61938333-61938355 ATGGAAGACTGGTGGGGAGAGGG - Intergenic
1054322516 9:63685454-63685476 CTGGTGGACCTGTGGGAAGAGGG - Intergenic
1054543123 9:66288576-66288598 CTGGTGGACCTGTGGGAAGAGGG + Intergenic
1054654252 9:67650162-67650184 ATGGAAGACTGGTGGGGAGAGGG + Intergenic
1055338123 9:75253617-75253639 GTGGGGGGCTGGTGGGGAGGTGG - Intergenic
1056516806 9:87359809-87359831 CTGGGGTAGTGGTGGCCACAGGG + Intergenic
1056850894 9:90082640-90082662 CAGGGTGACAGGTGGGCAGGTGG + Intergenic
1057206678 9:93177766-93177788 ATGGGGGTCTGGAGTGCAGAGGG - Intergenic
1057704137 9:97385880-97385902 CTGGGGGCCTGGTGGCTGGATGG + Intergenic
1057910077 9:99013309-99013331 CTGGGTGACTGGAGGGCAAGTGG - Intronic
1058186729 9:101864040-101864062 ATGGGGGACTGGTGGGGTGCAGG + Intergenic
1059667561 9:116463204-116463226 CTGAGAGACTGGTTGGGAGATGG - Intronic
1060319022 9:122538140-122538162 CAGGGGGACTGGGGGGCTGTTGG - Intergenic
1060447968 9:123709275-123709297 CTGGGGCACTGGTGCTCAGAGGG - Intronic
1060807761 9:126588255-126588277 CAGGGAGGCTGGTGGGCAAAGGG - Intergenic
1060824366 9:126679509-126679531 ATGGGGGACAGGTGGATAGATGG + Intronic
1061180478 9:129022475-129022497 GTGGGGGAGTGGTGGGGAAAGGG + Intronic
1061244587 9:129394901-129394923 TTGGGGGTCTGCTGGGCAGAGGG - Intergenic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061412717 9:130430018-130430040 CTGGGGCACTGAAGGGCTGAGGG + Intronic
1061487651 9:130928516-130928538 CTGGGTGACTGATGGGAAGGTGG - Intronic
1061592229 9:131605064-131605086 CTCTGAGACTGGTGGGCAGGTGG + Intronic
1061660673 9:132128184-132128206 CTGGGGGACTCGAGGCCAGTTGG - Intergenic
1061678729 9:132232215-132232237 CTGGGGGCCAGGTGGGGACAGGG - Intronic
1061813974 9:133182177-133182199 CTGGGGGCCTGGTGGCCAGATGG + Intergenic
1061826447 9:133261108-133261130 GTTGGGGACTGGAGGTCAGAAGG + Intronic
1061920615 9:133780391-133780413 CTGGGGGACTCGGGGGCAGGAGG + Intronic
1061954939 9:133956387-133956409 CTGGGGGCCTGGTGGGGAAAGGG + Intronic
1061972801 9:134053928-134053950 GTGGGTGGTTGGTGGGCAGAAGG - Intronic
1062050941 9:134446717-134446739 CTGGGGGGCTGGGGGGCTGCTGG + Intergenic
1062061312 9:134496814-134496836 CTGGGGGAGAGGTGTGCAGATGG - Intergenic
1062197583 9:135282816-135282838 CTGGGGGCCTCCTTGGCAGAAGG + Intergenic
1062250938 9:135593039-135593061 CTGGGGGACTCGGGGGCTGGGGG + Intergenic
1062250987 9:135593147-135593169 CTGGGGGACTCGGGGGCTGGGGG + Intergenic
1062421275 9:136483774-136483796 CTGGGAGGCTGGAGGGCAGGCGG + Exonic
1062486706 9:136780537-136780559 ATAGGGTAATGGTGGGCAGAGGG + Intergenic
1062521266 9:136958983-136959005 CTGGGGGACTTGCGGGGAGGAGG - Intergenic
1062522053 9:136961971-136961993 CAGGGGGACAGGTGGGCTGAGGG + Intergenic
1062549618 9:137079979-137080001 CTGGGGCACGGGAGAGCAGAGGG - Intronic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1062735238 9:138133690-138133712 ATAGGGTAATGGTGGGCAGAGGG - Intergenic
1202789404 9_KI270719v1_random:71151-71173 CTGGTGGACCTGTGGGAAGAGGG - Intergenic
1203549011 Un_KI270743v1:152994-153016 CTGGGGGACTCCTGGGCGCATGG + Intergenic
1203661266 Un_KI270753v1:45776-45798 CTGGGGGACCGGTGGCCGTAGGG + Intergenic
1203672450 Un_KI270755v1:28868-28890 CTGGGGGACCGGTGGCCCGAGGG + Intergenic
1187250127 X:17590191-17590213 CTGGGGGACTGTGTGGCAGTTGG + Intronic
1188262161 X:28034634-28034656 CAGGCTGACTGGTGGTCAGAAGG + Intergenic
1188586710 X:31785599-31785621 TTGGGGGATTGGGGGGCAGAGGG - Intronic
1189295619 X:39915425-39915447 CTGGGGGAGAGATGGGCAGGTGG + Intergenic
1190139573 X:47830822-47830844 ATGGGGGGCTGGTGGGGAGGTGG + Intergenic
1190255849 X:48761799-48761821 CTGGCAGCCTGGAGGGCAGATGG - Exonic
1190276975 X:48905145-48905167 GTGGGGCTCTGGTGGGCTGAGGG - Exonic
1190521105 X:51280082-51280104 CGGGGCGGCTGCTGGGCAGAGGG - Intergenic
1192033984 X:67544438-67544460 CGGGGGGGCGGGTGGGGAGAAGG - Intronic
1192252136 X:69422148-69422170 CTGGGTGGCTGCTGGGCGGAGGG - Intergenic
1192340527 X:70259812-70259834 CTTGGGAAGTGGTGGGCAGCAGG + Intergenic
1193344342 X:80387997-80388019 CTGGGGAAGTGGTGGCCAGCAGG - Intronic
1193924344 X:87466025-87466047 CGGGGCGGCTGCTGGGCAGAGGG - Intergenic
1193926320 X:87489727-87489749 CTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1195696946 X:107674382-107674404 CTGGGGGACCATTTGGCAGAAGG - Intergenic
1196778534 X:119362148-119362170 CAGGGTGGCTGCTGGGCAGAGGG - Intergenic
1198890672 X:141392241-141392263 TTGGGGTGCTGGTGGGCACAGGG + Intergenic
1200071422 X:153531257-153531279 CTGGGGAGCAGGTGGGGAGAGGG - Intronic
1201948262 Y:19535717-19535739 CGGGGCGGCTGCTGGGCAGAGGG - Intergenic
1202163345 Y:21958584-21958606 ATGGGGGCCTGGTAGGGAGATGG + Intergenic
1202228011 Y:22627784-22627806 ATGGGGGCCTGGTAGGGAGATGG - Intergenic
1202315146 Y:23568392-23568414 ATGGGGGCCTGGTAGGGAGATGG + Intergenic
1202555655 Y:26102201-26102223 ATGGGGGCCTGGTAGGGAGATGG - Intergenic