ID: 995035471

View in Genome Browser
Species Human (GRCh38)
Location 5:107529483-107529505
Sequence TTGTGCTGCCTGGAGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 239}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995035471_995035480 29 Left 995035471 5:107529483-107529505 CCTGGACACTCCAGGCAGCACAA 0: 1
1: 0
2: 1
3: 25
4: 239
Right 995035480 5:107529535-107529557 AGAGACAGGAAAAGGCATGGAGG 0: 1
1: 1
2: 8
3: 127
4: 1101
995035471_995035477 21 Left 995035471 5:107529483-107529505 CCTGGACACTCCAGGCAGCACAA 0: 1
1: 0
2: 1
3: 25
4: 239
Right 995035477 5:107529527-107529549 GACCATTGAGAGACAGGAAAAGG 0: 1
1: 1
2: 1
3: 30
4: 350
995035471_995035479 26 Left 995035471 5:107529483-107529505 CCTGGACACTCCAGGCAGCACAA 0: 1
1: 0
2: 1
3: 25
4: 239
Right 995035479 5:107529532-107529554 TTGAGAGACAGGAAAAGGCATGG 0: 1
1: 4
2: 8
3: 98
4: 785
995035471_995035476 15 Left 995035471 5:107529483-107529505 CCTGGACACTCCAGGCAGCACAA 0: 1
1: 0
2: 1
3: 25
4: 239
Right 995035476 5:107529521-107529543 GATTTTGACCATTGAGAGACAGG 0: 1
1: 0
2: 2
3: 20
4: 156
995035471_995035475 -7 Left 995035471 5:107529483-107529505 CCTGGACACTCCAGGCAGCACAA 0: 1
1: 0
2: 1
3: 25
4: 239
Right 995035475 5:107529499-107529521 AGCACAATCTGGAAATGCATGGG 0: 1
1: 0
2: 1
3: 12
4: 172
995035471_995035474 -8 Left 995035471 5:107529483-107529505 CCTGGACACTCCAGGCAGCACAA 0: 1
1: 0
2: 1
3: 25
4: 239
Right 995035474 5:107529498-107529520 CAGCACAATCTGGAAATGCATGG 0: 1
1: 0
2: 0
3: 32
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995035471 Original CRISPR TTGTGCTGCCTGGAGTGTCC AGG (reversed) Intronic
900404487 1:2486432-2486454 CTGTGATGCCTGGGGTGGCCTGG + Intronic
900911176 1:5597950-5597972 TTCTGGTCCCTGGAATGTCCAGG - Intergenic
901114789 1:6834675-6834697 TTGTCCTGGCTGGAGTGTAGTGG + Intronic
903032549 1:20474247-20474269 TTGTCCAGGCTGGAGTGTACTGG - Intergenic
904087245 1:27917457-27917479 TTGTCCAGGCTGGAGTGTACTGG - Intergenic
904458530 1:30661872-30661894 TTCTGATTCCTGGAGTCTCCAGG + Intergenic
904644638 1:31956673-31956695 TTGTCCAGGCTGGAGTGTACTGG + Intergenic
904959800 1:34323377-34323399 CTGAGCTGCCTTGGGTGTCCAGG + Intergenic
905553242 1:38860127-38860149 TATTGATGCCTGCAGTGTCCTGG + Intronic
906509842 1:46404750-46404772 TCTTGCTCCCTTGAGTGTCCCGG + Intronic
908115584 1:60936888-60936910 GTGTCCTGGCTAGAGTGTCCAGG - Intronic
911264413 1:95726281-95726303 GTGTGCTGCCTTGGGTGTCCTGG - Intergenic
911349129 1:96730807-96730829 TTATACTCCCTTGAGTGTCCAGG - Intronic
912951673 1:114124588-114124610 TTGTGTTGCTTGGAGTGTGGTGG + Intronic
915277535 1:154799922-154799944 TTTTGCTGCCTGCATGGTCCTGG + Intronic
917397370 1:174608343-174608365 AGGTGCTGCCTGTAGTGGCCAGG + Intronic
919930506 1:202218336-202218358 TTGTCCAGCCTGGAGTGTAGTGG + Intronic
920114039 1:203607324-203607346 TTGTGCTGCCTCAAGGCTCCTGG - Intergenic
921424329 1:214984770-214984792 TAGTCATGGCTGGAGTGTCCGGG - Intergenic
924805909 1:247361499-247361521 TTGAGCTGCCTGGAGTGGTCTGG - Intergenic
1063132911 10:3193945-3193967 TTCGGGTGCCTGGTGTGTCCTGG + Intergenic
1063560319 10:7120208-7120230 TGCTGATGCCTGGAGTGTACAGG - Intergenic
1063794191 10:9492407-9492429 TTGTCCAGCCTGGAGTGCCCTGG - Intergenic
1063828300 10:9923829-9923851 TTCTGCTCCTTGGAGTTTCCTGG + Intergenic
1065323943 10:24534213-24534235 TTGAGCTGCCTGGATTTTGCAGG + Intronic
1066601780 10:37116725-37116747 TTGTCCAGGCTGGAGTGCCCTGG + Intergenic
1070561566 10:77571415-77571437 TTTTGCAGCGTGGAGTCTCCTGG + Intronic
1070627488 10:78061678-78061700 TTGTGTCTCCTGGACTGTCCTGG + Intergenic
1070685828 10:78480102-78480124 TTGTGCAGCCTCAGGTGTCCAGG - Intergenic
1070730823 10:78827063-78827085 GTGTGCTGCCTGGTGGCTCCTGG - Intergenic
1072759445 10:98043892-98043914 GTGTGCTGGCTTGAGTGTCATGG - Intergenic
1073312094 10:102550246-102550268 TTGTTTTGCCTGGTGTTTCCTGG + Intronic
1073366921 10:102950712-102950734 TTGTCCAGGCTGGAGTGTACTGG - Intronic
1073559332 10:104483380-104483402 GAGTGCTGCTTGGAGGGTCCAGG + Intergenic
1074777112 10:116774796-116774818 TTGTGCAGCCTGCAGGGTCAGGG - Intergenic
1075965712 10:126609980-126610002 GTGTTCTGCCTGGAGGCTCCTGG - Intronic
1076121956 10:127943610-127943632 TTCTGCTGCCTGGAATGCGCAGG + Intronic
1076215792 10:128692672-128692694 TCCTGTTGCCTGGAGTGTCGGGG + Intergenic
1076394679 10:130129998-130130020 TTTTGCTGCCAGGAAAGTCCAGG + Intergenic
1076528190 10:131126012-131126034 CTGGGCTGCCTGGAATCTCCAGG + Intronic
1076725652 10:132411737-132411759 TGGTGCTCACTGGAGTCTCCGGG + Intronic
1076997880 11:307814-307836 TTGTGGGGCCTGGAGTGTGGAGG + Intronic
1077000777 11:321180-321202 TTGTGGGGCCTGGAGTGTGGAGG - Intronic
1077095582 11:797708-797730 TCCTGCTGGCTGGAGGGTCCCGG + Exonic
1082130993 11:48489211-48489233 TTGTGCTGCTGGTAGTGTCCTGG + Exonic
1082245551 11:49917969-49917991 TTGTGCTGCTGGTGGTGTCCTGG - Intergenic
1082245812 11:49920896-49920918 TTTTGCTGCTGGTAGTGTCCTGG - Intergenic
1082564494 11:54660085-54660107 TTTTGCTGCTGGTAGTGTCCTGG + Intergenic
1082836832 11:57657343-57657365 TTGTGCTTCGTGGCTTGTCCAGG + Exonic
1083609996 11:64000058-64000080 ATGTGCTTCCTGGGGTGTGCGGG + Intronic
1083952513 11:65964911-65964933 TTGTGCTGCATGGGTTGGCCAGG + Intronic
1085395337 11:76204376-76204398 TTGTGGTGCCTGGTTTCTCCAGG + Intronic
1085688063 11:78643335-78643357 TTGTCTTGCTTGGAGTTTCCGGG + Intergenic
1087160715 11:94945549-94945571 TTGTGCTGCCTGGAGAGGGCAGG + Intergenic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1089240321 11:117072346-117072368 TTGTGCAGGCTGGAGTGCCGTGG - Intronic
1091585275 12:1812304-1812326 TGGTGGTGCCTGTAGTTTCCTGG - Intronic
1091629638 12:2149979-2150001 TAGTGATGCATGGGGTGTCCAGG + Intronic
1091840588 12:3617649-3617671 TTGTGCTGCCTGCATGGTGCGGG + Intronic
1092023742 12:5223587-5223609 TGCTTCTGCCTGGATTGTCCTGG + Intergenic
1092951344 12:13506470-13506492 TTCTGCTGGATAGAGTGTCCTGG + Intergenic
1097059835 12:56274490-56274512 TTGTCCTGGCTGGAGTGTAGTGG + Intronic
1097227393 12:57486307-57486329 TTGTGCAGGCTGGAGTGTAGAGG + Intronic
1100627906 12:96355442-96355464 TTGTGCAGTCTGGAGTGTAATGG + Intronic
1101961742 12:109256064-109256086 TTGCACAGCCAGGAGTGTCCTGG + Intronic
1102435482 12:112919489-112919511 GGATGCTGCCTGGAGTGTGCTGG - Exonic
1103996730 12:124834866-124834888 TTGTGCAGCCTGGAGTGTAGTGG - Intronic
1104775073 12:131386053-131386075 TGGGGCTGCCTGGAGAGCCCGGG + Intergenic
1104798548 12:131537036-131537058 TCCTGCTGCCTGGAGGGGCCAGG - Intergenic
1105295352 13:19084451-19084473 TTGCGCTGCCTGGAGTGCAGTGG - Intergenic
1105882336 13:24615737-24615759 TCCTGCTGCCTGGGGTCTCCAGG + Intergenic
1106563212 13:30864139-30864161 GTAGGCTGCCTGTAGTGTCCCGG - Intergenic
1108253568 13:48590027-48590049 TTCTGCTTCCTGCAGTGTTCTGG + Intergenic
1109168881 13:59071541-59071563 TTGTGCTGCATGAAGTGAACAGG + Intergenic
1111557539 13:89901133-89901155 TTGTGCTGAGTGCACTGTCCTGG + Intergenic
1111647322 13:91047137-91047159 ATGAGCTGCCTGGAGTGCCACGG + Intergenic
1112283626 13:98084473-98084495 TTGTCCTGCCTGGAGTGCAGTGG - Intergenic
1113458611 13:110466336-110466358 GTGTGCTGCCAGGAGGGTCCAGG + Intronic
1114033961 14:18603576-18603598 TTGTTCTACCTGGAATGTCCGGG - Intergenic
1114078756 14:19182749-19182771 TTGTTCTACCTGGAATGTCCGGG - Intergenic
1114124684 14:19711435-19711457 TTGTTCTACCTGGAATGTCCGGG + Intergenic
1119125461 14:72121708-72121730 GTCTTCTGCCTGGAGAGTCCTGG + Intronic
1119338274 14:73852863-73852885 TTGCCCAGGCTGGAGTGTCCTGG + Intronic
1123510916 15:20998971-20998993 TTGTTCTACCTGGAATGTCCAGG + Intergenic
1123568139 15:21572730-21572752 TTGTTCTACCTGGAATGTCCAGG + Intergenic
1123604246 15:22008052-22008074 TTGTTCTACCTGGAATGTCCAGG + Intergenic
1124552189 15:30692088-30692110 TTGTCCTGGCTGGAGTGTAGTGG + Intronic
1124637335 15:31373576-31373598 TTGTCCTGCCTGGAGGCTCCAGG + Exonic
1124679052 15:31713577-31713599 TTGTCCTGGCTGGAGTGTAGTGG - Intronic
1125230259 15:37446611-37446633 TTGTCCAGGCTGGAGTGTACTGG - Intergenic
1127130157 15:55854107-55854129 TTGTCCAGGCTGGAGTGCCCAGG - Intronic
1127499267 15:59541524-59541546 TCCTGCTGCCTGGACTCTCCTGG + Intergenic
1128552664 15:68608416-68608438 TTGGGCTGCCTGGCCTGGCCAGG - Intronic
1128646328 15:69381224-69381246 TTCTCCTCCCTGGAGTGGCCAGG + Intronic
1129105556 15:73304962-73304984 TTGTGTGTCCTGTAGTGTCCTGG + Exonic
1129458237 15:75687104-75687126 TTGTGCTCCCAGGAGTTTCTGGG - Intronic
1129725545 15:77899762-77899784 TTGTGCTCCCAGGAGTTTCTGGG + Intergenic
1129772948 15:78214221-78214243 TCCTGCTTCCTGGAGTTTCCTGG + Intronic
1130321606 15:82847073-82847095 TTGTGCTGCCTGGAAGCTGCAGG - Intronic
1132083634 15:98888131-98888153 TGGAGCTGCCTGGTGTTTCCTGG - Intronic
1202976496 15_KI270727v1_random:299818-299840 TTGTTCTACCTGGAATGTCCAGG + Intergenic
1133692477 16:8229991-8230013 TGGTGCTTCCTGGATTGTACAGG - Intergenic
1135056349 16:19235004-19235026 TTGTGCTCCCTGAAGTTTCTTGG + Intronic
1138791262 16:59906732-59906754 TTGTCCAGGCTGGAGTGTACTGG + Intergenic
1139260327 16:65586807-65586829 TTGTTCTTCCTGGAGTTTCCTGG + Intergenic
1139954535 16:70686810-70686832 TTTCCCTGCCTGGAGTCTCCAGG - Intergenic
1140200783 16:72893031-72893053 TCTTGCTGCCTGGAATATCCTGG - Intronic
1142310648 16:89310901-89310923 TCGTGCTGCCTGGAGTCTGCAGG + Intronic
1142602514 17:1061151-1061173 CTGTGCTGCCTGGGGTGTGCCGG - Intronic
1143449856 17:7029637-7029659 CTGTGCTGCCTGCTGTGTCCTGG + Exonic
1144791412 17:17861436-17861458 TTTTTCTGCCTGGAGTCTTCTGG - Intronic
1147142241 17:38466346-38466368 TCCTGCTGCCTGGAGTGACCCGG + Exonic
1147157552 17:38551912-38551934 TTCTCTTGCCAGGAGTGTCCAGG + Exonic
1148518891 17:48249632-48249654 TTGCTCTGCCTGGAGTGCCGAGG - Intronic
1150448450 17:65245830-65245852 TTGTCCAGCCTGGAGTGTAATGG + Intergenic
1150683568 17:67302482-67302504 CTGTGCTTCCTGGAGAATCCAGG - Intergenic
1151619372 17:75236335-75236357 TTGTGGTGACTGCAGTGTCTTGG + Intergenic
1151813657 17:76460186-76460208 TTGCTCAGGCTGGAGTGTCCTGG + Intronic
1152540436 17:80971862-80971884 TTGTCCTCCCTGGAGGGCCCTGG - Intergenic
1152594982 17:81233574-81233596 TTCTGCCTCCTTGAGTGTCCTGG - Intronic
1153287320 18:3468565-3468587 TTGTGCAGGCTGGAGTGCCATGG - Intergenic
1155796649 18:30045772-30045794 TTTCGCTGGCTGGAGTGCCCTGG - Intergenic
1156354631 18:36330604-36330626 TTTTGCTGGCTGGTGTATCCAGG + Intronic
1157570457 18:48708910-48708932 CTGTGCTGCCTTGTTTGTCCTGG + Intronic
1158135451 18:54202912-54202934 TGGTTCTGCCTGGAGTATGCAGG + Intronic
1161409023 19:4106327-4106349 TTGTCCAGCCTGGAGTGTACTGG - Intronic
1161510744 19:4669877-4669899 GTCGCCTGCCTGGAGTGTCCAGG - Intronic
1162357141 19:10193311-10193333 TTGTCCAGGCTGGAGTGCCCTGG - Intronic
1165263972 19:34645348-34645370 CTGTCCTCCCTGGAGTGTCCTGG - Intronic
1167265172 19:48479485-48479507 GGGTGCTGCCTGGGCTGTCCCGG + Intronic
1167497847 19:49829937-49829959 TCGTGCTGCCTGGTGAGGCCTGG + Exonic
1167921267 19:52785285-52785307 TTGTGCAGGCTGGAGTGCACCGG + Intronic
1168081033 19:54010612-54010634 TTGTCCAGGCTGGAGTGTACTGG + Intronic
925771771 2:7289182-7289204 TTGTGTTGCCTGGGAGGTCCTGG + Intergenic
925809706 2:7687087-7687109 TTGAGCTGCTGGGATTGTCCTGG + Intergenic
929789339 2:45012045-45012067 TAGTGTTGCCTGGAGGCTCCTGG - Intergenic
931455079 2:62403511-62403533 TTGTCCAGGCTGGAGTGTACTGG + Intergenic
932191857 2:69747723-69747745 TAGTCCAGCCTGGAGTGCCCTGG + Intronic
932522753 2:72430605-72430627 TTGTCCAGGCTGGAGTGTACTGG - Intronic
932550544 2:72765245-72765267 TTGCCCTGGCTGGAGTGTACTGG - Intronic
935098960 2:99973934-99973956 TTCTGCTGCTTGGGGTGTCTTGG - Intronic
935688803 2:105711994-105712016 GTGTGGTGGCTGGAGTGTCGTGG + Intergenic
936628065 2:114170022-114170044 CTGTGCTGCCTTGGGTCTCCTGG + Intergenic
937470672 2:122171612-122171634 TTGGGATGCCTGCACTGTCCTGG + Intergenic
942091349 2:172494466-172494488 TTGTCCTGGCTGGAGTGTAGTGG - Intronic
942091490 2:172495774-172495796 TTTTGCAGCCTGGAGTGGCAGGG - Intronic
945672333 2:212817108-212817130 TTCTGCTTCCTGGAGAGCCCAGG + Intergenic
946385897 2:219384335-219384357 ATGTGCTGCCTGGGGCGCCCCGG + Intronic
948202947 2:236142899-236142921 TTTCTCTGCCTGCAGTGTCCTGG + Intergenic
948590126 2:239044064-239044086 TGGTGCTGCCTGGACTCTCTGGG - Intergenic
1169295430 20:4393366-4393388 TTTTGTTCCCTGGAGTGCCCAGG + Intergenic
1169455459 20:5748700-5748722 TCGTCCAGGCTGGAGTGTCCTGG - Intergenic
1170965286 20:21063279-21063301 CTGTTCTGCCTGGCTTGTCCTGG - Intergenic
1174323617 20:49761800-49761822 TTGTCCAGGCTGGAGTGTCGTGG + Intergenic
1174797376 20:53533455-53533477 TTGTCCTGCCTGGAGTGCAGTGG - Intergenic
1175886902 20:62297244-62297266 CTGTGCTGGCTGGAGGGTCAGGG + Intergenic
1175886993 20:62297748-62297770 CTGTGCTGGCTGGAGGGTCAGGG - Intergenic
1176665404 21:9682259-9682281 TTGTGCTTCCCTGAGTCTCCAGG - Intergenic
1177203949 21:17989462-17989484 TTGTGCTCCCTGGAGTTTGGGGG - Intronic
1178966385 21:37123323-37123345 CTGTGCTGCCAGGAGTTTCATGG - Intronic
1179459847 21:41526961-41526983 GTGTGCTGCCTGGGGTGACCAGG - Intronic
1180458080 22:15530618-15530640 TTGTTCTACCTGGAATGTCCGGG - Intergenic
1181863447 22:25836920-25836942 TTGTCCAGGCTGGAGTGCCCTGG - Intronic
1182151662 22:28031439-28031461 GTCTGCTGCCTGCAGTGCCCTGG - Intronic
1182420629 22:30247009-30247031 TTTTCCTGCCTGGCTTGTCCCGG + Intergenic
1184737314 22:46406861-46406883 TTTTGCTGCCGAGTGTGTCCTGG - Intronic
952701284 3:36330527-36330549 TTGTGATGCCTGGTCTTTCCTGG + Intergenic
953756569 3:45651670-45651692 TTGTGCAGGCTGGAGTGTAGTGG + Intronic
954998498 3:54904246-54904268 TTGTTCTCCCTGGAGAGACCTGG + Intronic
955380108 3:58431489-58431511 TTGTCCAGCCTGGAGTGCACTGG - Intronic
957040489 3:75332197-75332219 TTGTGGTGCCTGGATTGACATGG + Intergenic
961306070 3:125959636-125959658 TTCTGCTGCCTTGGCTGTCCCGG - Intergenic
962546824 3:136444898-136444920 TTGCGCAGCCTGGAGTGCACTGG + Intronic
964823769 3:160802999-160803021 TTGAGCTTTCTGGAGTATCCAGG - Intronic
968571085 4:1341051-1341073 TTGTTCTGCCTGGAGAGCACAGG - Intergenic
968644502 4:1732884-1732906 TAGTGCTGCCTCGAATGTTCAGG + Intronic
968874857 4:3261250-3261272 TTGTTCAGCCTTGGGTGTCCTGG - Intronic
969444460 4:7236322-7236344 TTCTGCTGCCTGGAATGCTCAGG - Intronic
973771005 4:54206542-54206564 ATGTGCTCCCTTGAGAGTCCTGG + Intronic
974888071 4:67844737-67844759 TTGTCCAGGCTGGAGTGTACTGG - Intronic
975539320 4:75489033-75489055 TTGTGCAGCCTGGAGTGCAGTGG - Intronic
978585270 4:110270010-110270032 TTGTCCAGGCTGGAGTGCCCTGG + Intergenic
982340937 4:154297950-154297972 TTGTCCTGGCTGGAATGCCCTGG + Exonic
983852914 4:172605591-172605613 TTCCTCTGCCTGGAATGTCCTGG - Intronic
984477106 4:180249652-180249674 TTGTCCAGGCTGGAGTGTACTGG - Intergenic
985192676 4:187393235-187393257 TTGTGTTACCTGGACTTTCCGGG + Intergenic
985574873 5:669403-669425 GTGGGCTGCCTGGGGTGGCCTGG - Intronic
986234435 5:5894033-5894055 TTGTGCAGGCTGGAGTGTAGTGG + Intergenic
986664361 5:10087442-10087464 TAGTGCTGGCTGTGGTGTCCAGG + Intergenic
987018584 5:13846526-13846548 TTTTGCTGAGTGGGGTGTCCAGG + Intronic
987160111 5:15132995-15133017 TTCTGCTGCCTGGAGTCTGGAGG + Intergenic
987589737 5:19909337-19909359 TTGCCCTGCCTGGAGTGTAGTGG + Intronic
990857062 5:60280035-60280057 TTGCCCAGCCTGGAGTGCCCTGG - Intronic
991966479 5:72096451-72096473 TTGTGCAACCTGGACTGTTCAGG + Intergenic
993447171 5:88027544-88027566 TTGTGCAGCCTGGGGTGGCAAGG - Intergenic
994181611 5:96773212-96773234 TGGTGCTTCCTGGTTTGTCCAGG - Exonic
994719218 5:103361670-103361692 TTGTGGTGCCTAGAGTGGGCCGG + Intergenic
995035471 5:107529483-107529505 TTGTGCTGCCTGGAGTGTCCAGG - Intronic
995847834 5:116513165-116513187 TTGTCCAGCCTGGAGTGTAATGG + Intronic
998376451 5:141694111-141694133 TTTTGGTGCCTGGGGTCTCCTGG + Intergenic
999724807 5:154427787-154427809 TTGTCCAGCCTGGAGTGTAGTGG - Intergenic
1000491650 5:161921911-161921933 TGGTGCTGCCTGGACTGCCTTGG - Intergenic
1000870432 5:166570437-166570459 TTGTGATTCCTGGGGTATCCAGG - Intergenic
1001969288 5:175940574-175940596 CCTCGCTGCCTGGAGTGTCCAGG + Intronic
1002248148 5:177903175-177903197 CCTCGCTGCCTGGAGTGTCCAGG - Intergenic
1004547370 6:16610988-16611010 TGGTGCAGCCTGGAGTGCACTGG - Intronic
1006618714 6:35347422-35347444 TTTTGCTGCCTGTTGTGTCTAGG + Intronic
1006930929 6:37687982-37688004 TGGTGCTAACTGGAGGGTCCAGG - Intronic
1007292233 6:40796668-40796690 TGCCGCTGGCTGGAGTGTCCTGG - Intergenic
1007704752 6:43783886-43783908 TTGAGCTGCCTGGAGGTTGCAGG - Intronic
1008605240 6:53133529-53133551 TTGTGCGGCCTGGAGTGCAGTGG + Intronic
1011586420 6:88931297-88931319 ATGTGCTACCTTGAGTGTGCAGG + Intronic
1013422420 6:109978650-109978672 TTGCGAAGCCTGGAGAGTCCTGG - Intronic
1015600092 6:134903289-134903311 TTCTACTGCCTTGAGTGCCCTGG - Intergenic
1017202645 6:151772676-151772698 TTGTGCTGACTGGAAAATCCCGG + Intronic
1017522666 6:155215845-155215867 TTGTGCAGCCTGGAGTGCAGTGG + Intronic
1018327185 6:162684301-162684323 TTCTGCTGCCTTGATTTTCCTGG - Intronic
1022173380 7:27850544-27850566 TTGTGGTTCCAGCAGTGTCCTGG - Intronic
1023771564 7:43561212-43561234 TCTGGATGCCTGGAGTGTCCTGG - Intronic
1028921506 7:96315132-96315154 TAGTCCTGCCTGGTGTCTCCAGG - Intronic
1030012467 7:105184013-105184035 TTGTGCAGGCTGGAGTGTAGTGG + Intronic
1030060704 7:105618686-105618708 TTGTCCTTCCTGGACTGTCTAGG + Intronic
1030814902 7:114023784-114023806 ATGTTGTGCCTGGACTGTCCAGG + Intronic
1033003599 7:137535580-137535602 TTTTGTTGCCTTGAGTGTGCAGG - Intronic
1033381740 7:140827411-140827433 TTATACTGCCTGCATTGTCCAGG - Intronic
1033810138 7:145002306-145002328 TTGTGCTGCCTGTAGGCTCAGGG + Intergenic
1034605441 7:152308633-152308655 TTGTGCAGGCTGGAGTGTGGTGG - Intronic
1035291853 7:157844342-157844364 TTCAGCTGCCTGGAGGGTGCAGG - Intronic
1035356560 7:158279446-158279468 TTGGGCTGCCTGGAGTGCCCGGG - Intronic
1035656661 8:1313060-1313082 CTGTGCTGACTGGTGTGTGCCGG + Intergenic
1036660685 8:10706531-10706553 TAGTGCTTCCTGCAGAGTCCTGG - Intronic
1037690502 8:21177666-21177688 ATGTGCTGCTTGTAGTCTCCGGG + Intergenic
1037848530 8:22306468-22306490 TTGTGGGGCCCTGAGTGTCCTGG + Intronic
1039573073 8:38602430-38602452 TTGTACCGGCTGGAGTGTACTGG + Intergenic
1040668868 8:49662608-49662630 TTGCCCTGGCTGGAGTGTACTGG + Intergenic
1040707331 8:50144950-50144972 TTGAGCTGCCTGCAGTGCTCTGG + Intronic
1042778697 8:72466062-72466084 TTGTGCAGCCTCGAGTCTACAGG + Intergenic
1043812926 8:84765088-84765110 CTGTGCTGCCTGCAATTTCCTGG - Intronic
1045236736 8:100358738-100358760 TTGTCCAGCCTGGAGTGCCATGG - Intronic
1048931789 8:139321143-139321165 TGGTGCTGACTGGAGGCTCCTGG + Intergenic
1049006183 8:139857092-139857114 TCCTTCTGCCTGGAGTGCCCTGG - Intronic
1049870738 8:144973465-144973487 TCATGCTGCCTGGAGAGTCAGGG + Intergenic
1050299362 9:4241706-4241728 TTGCTCTGTCTGGAATGTCCAGG + Intronic
1050801579 9:9621825-9621847 GTGTGCTGCCTGTGGTGTTCTGG + Intronic
1052320246 9:27159844-27159866 TTGTTCTGCCTGGAATGATCTGG + Intronic
1052345607 9:27406876-27406898 TTGTGCTGGCTGGAGTGCAATGG + Intronic
1052994474 9:34543620-34543642 TTGTTCTGGCTGGAGTGACATGG - Intergenic
1053292479 9:36890476-36890498 CCGTGTTGCCTGGAGTGTGCAGG - Intronic
1054917835 9:70512025-70512047 TTGTCCTGGCTGGAGTGCCGTGG + Intergenic
1055804094 9:80073846-80073868 TTGTGCAGGCTGGAGTGTAGTGG + Intergenic
1056258302 9:84822984-84823006 ATGTTCAGCCAGGAGTGTCCAGG - Intronic
1057238076 9:93381803-93381825 TTGTCCTGCCTGGAGTGCAGTGG - Intergenic
1059359559 9:113730784-113730806 TTGTGCTGGCTGGAGTGTAATGG - Intergenic
1059453886 9:114387769-114387791 TCCGGCTGCCTGGACTGTCCCGG + Intronic
1060597637 9:124857746-124857768 TGGTGGGGCCTGGAGAGTCCTGG - Exonic
1061524029 9:131143044-131143066 TTGTGCAGGCTGGAGTGTAGTGG + Intronic
1062042628 9:134411173-134411195 CAGTGCAGCCTGGAGGGTCCGGG - Intronic
1062057297 9:134475258-134475280 TCCTGCTGCCTGGAGAGGCCTGG + Intergenic
1062268191 9:135696902-135696924 GGGTGGTGCCTGGGGTGTCCTGG - Intronic
1203660695 Un_KI270753v1:39501-39523 TTGTGCTTCCCTGAGTCTCCAGG + Intergenic
1185517476 X:711127-711149 TTGTCCAGACTGGAGTGTACTGG + Intergenic
1186365930 X:8893364-8893386 TTGTTCCTCCTGGAGTGTCTAGG + Intergenic
1193071540 X:77311057-77311079 TTGCGCAGCCTGGAGTGCACTGG - Intergenic
1195704779 X:107730864-107730886 TCCTGCTGCCTGGAGTTTCATGG + Intronic
1198265289 X:135003166-135003188 TTGTGCAGGCTGGAGTGTAGTGG - Intergenic
1199568655 X:149245813-149245835 TTCTGCTTCCTGGAGCTTCCTGG + Intergenic