ID: 995037139

View in Genome Browser
Species Human (GRCh38)
Location 5:107547142-107547164
Sequence CCTACTGTACACATGGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995037139 Original CRISPR CCTACTGTACACATGGATCA TGG Intronic
900921140 1:5671365-5671387 CCTTCTGAACACAGGGACCATGG - Intergenic
902117731 1:14135962-14135984 CCCACTTTACACTTGGTTCATGG + Intergenic
902595257 1:17505256-17505278 CCTACTGCAGACATGTAACAAGG - Intergenic
911557621 1:99364152-99364174 CCTACTGTATACATGTAGCAGGG - Intergenic
915837252 1:159187827-159187849 CCTTCTGTGCACATGGAGGATGG - Intronic
916161964 1:161925944-161925966 ACTAAAGTGCACATGGATCAAGG + Intronic
920664817 1:207955341-207955363 CTTACTGTATACAAGGATTATGG + Intergenic
923298220 1:232615657-232615679 GTTACTGGAGACATGGATCAGGG - Intergenic
1067282316 10:44881726-44881748 CCTTCTGTGCACCTGGAGCATGG - Intergenic
1070712226 10:78691132-78691154 CCTACTGTGCTCCTGGCTCAGGG + Intergenic
1073207847 10:101778123-101778145 CCTACTGTGTACAAGGATGAGGG - Intronic
1073378147 10:103054747-103054769 CCTACTGTACACATGCAGTGTGG - Intronic
1073521000 10:104129041-104129063 ACTGCTGTCCACAGGGATCATGG - Intergenic
1074206667 10:111288697-111288719 GCAACTGAACACATGGAGCAGGG + Intergenic
1078385946 11:10892823-10892845 CCTCTTGTACCCATTGATCAGGG + Intergenic
1080637967 11:34140149-34140171 CATACTGAACACATGGACCAAGG - Intronic
1085295014 11:75426576-75426598 CCATCTGCACACCTGGATCAAGG - Exonic
1085410746 11:76289000-76289022 CCTTCTGTACACTGGGATCCTGG - Intergenic
1087812742 11:102625497-102625519 ACAACTGTACACAGGAATCAGGG + Intergenic
1088860934 11:113799092-113799114 CCTTCTTTACACATGCAGCATGG + Exonic
1090087544 11:123663909-123663931 CCTACAGTTCCCATGTATCATGG - Intergenic
1091273333 11:134332676-134332698 CCTACTGTGCAAATAAATCATGG - Intronic
1091512137 12:1138581-1138603 CCTACTGAACACATCTTTCAAGG - Intronic
1092698534 12:11201196-11201218 ACTACTGAACACATGGAACATGG + Intergenic
1093393323 12:18650154-18650176 CCAAAAGTACACAGGGATCAGGG + Intergenic
1093899229 12:24611008-24611030 CTAACTGTACACATTGGTCAAGG - Intergenic
1095951745 12:47785382-47785404 CTTACTGTGCACCCGGATCACGG + Exonic
1102646425 12:114406725-114406747 CCTTGTGTACACCTGGAGCAGGG - Intronic
1111045699 13:82811171-82811193 CATATTGTACACATGTATCCTGG + Intergenic
1113182252 13:107642950-107642972 CCTAATTTCCACATGGATGAGGG + Intronic
1113251147 13:108453995-108454017 CACATTGTACACATGTATCAAGG + Intergenic
1115398014 14:32932128-32932150 CCTGGAGTACACATGGATCCAGG + Intergenic
1121701313 14:95956486-95956508 CCTACTGAACTCCTGGCTCATGG - Intergenic
1127116904 15:55737672-55737694 CCTAATTTACACATGAATAATGG + Intronic
1128130764 15:65225611-65225633 CCCACTGTTCACATGGGCCATGG - Intergenic
1133309142 16:4831615-4831637 CCTACTTTACACCTGCATCCAGG + Intronic
1134832543 16:17335258-17335280 CCTACTGGCCACCTGGAACAAGG + Intronic
1139025613 16:62814352-62814374 CCTTCTGGAAACATGGATGAGGG - Intergenic
1148188902 17:45665242-45665264 CCTCATGTCCACATGGACCAGGG - Intergenic
1150296056 17:64008111-64008133 ACTACTGTACACAACCATCAAGG + Intronic
1155226562 18:23734411-23734433 CCTTCAGTACACATGGGGCATGG + Intronic
1164062690 19:21689369-21689391 CCCACTGTACACATAGACCTGGG + Intergenic
925556741 2:5139407-5139429 CATCCTGCAGACATGGATCAAGG + Intergenic
929915752 2:46134192-46134214 CCTACTGGTCAAATGGATGAAGG - Intronic
945655260 2:212615540-212615562 CCTTCTGTTCACATAGATAATGG + Intergenic
948278154 2:236725828-236725850 CCTTCTGTCCACAAGGGTCACGG - Intergenic
1168956136 20:1835784-1835806 CCTCCTGTGCACAGGGCTCAGGG + Intergenic
1179183596 21:39065603-39065625 CCTAATGAATTCATGGATCAAGG + Intergenic
949113396 3:290631-290653 CCTACTGTACTCTAGGAACAGGG - Intronic
950874283 3:16256029-16256051 CCTGCTTTGCACATGGACCAAGG - Intergenic
951943135 3:28104072-28104094 CCTTCTGTTCACATGGCTCTGGG + Intergenic
952182577 3:30933718-30933740 CCTAGTGGACAAAAGGATCAGGG - Intergenic
952884405 3:38003608-38003630 CCTACAGTCCTCAGGGATCACGG + Intronic
959365990 3:105458059-105458081 CCTACTGTACACACACTTCAGGG + Intronic
962024812 3:131536800-131536822 CCCAGTATACACATGGACCATGG - Intronic
962879016 3:139558810-139558832 CATGATGCACACATGGATCAGGG + Intergenic
964345237 3:155748525-155748547 CCTACTCTACAAATTGGTCACGG + Intergenic
965417104 3:168409742-168409764 AATTCTGTACACATGTATCATGG + Intergenic
971014015 4:22468819-22468841 ACTAGTGAACACATGGATGATGG + Intronic
971387094 4:26150815-26150837 ACTAGTGTAAACATGGCTCAGGG - Intergenic
977532221 4:98213794-98213816 CCTACTGTACACAGTAGTCATGG + Intergenic
977635432 4:99292896-99292918 CCTACAGTATACATGGAGCTAGG - Intergenic
977638039 4:99323222-99323244 CCTATTGTACACATGAAACTAGG - Intergenic
978456210 4:108895254-108895276 ACTACAGTACAGATGGATAATGG - Intronic
978916542 4:114132318-114132340 CAGACTGTTCACATGGATCCAGG - Intergenic
984505046 4:180606971-180606993 CATACTGGACACATGAATTAAGG + Intergenic
986395666 5:7327149-7327171 CTTCCTGTGCACATGGATCCTGG + Intergenic
989534302 5:42546368-42546390 ACCACTGAACACATGGATGAGGG - Intronic
995037139 5:107547142-107547164 CCTACTGTACACATGGATCATGG + Intronic
995056788 5:107768464-107768486 CATTCTGTACCCATGGATCAAGG - Intergenic
999707869 5:154290575-154290597 CCTAATTTACACATGGATTGAGG - Intronic
1001324879 5:170715924-170715946 CCTCCTGCACACAGGGAACAGGG + Intronic
1014198851 6:118587066-118587088 CTTACTGTACAAATGGGCCATGG - Intronic
1016530468 6:145053658-145053680 CCTACTGTCCAGTTGGAACATGG + Intergenic
1024303290 7:47904377-47904399 CCTACTGTAGACATGGCTGCTGG + Exonic
1032521320 7:132547633-132547655 CCTACTGTACAGAAGAATCAAGG + Intronic
1035153073 7:156892133-156892155 CCAACAGCACACATGGAACATGG + Intronic
1037302940 8:17472028-17472050 CCTACTGTGCCCATGGAAAATGG + Intergenic
1046015427 8:108599192-108599214 ACCAATGTACACTTGGATCAAGG - Intergenic
1046049213 8:109001146-109001168 CCTTATGTACAAATTGATCAGGG + Intergenic
1046645480 8:116781434-116781456 CTTACTGTGCACCAGGATCATGG + Intronic
1053645629 9:40118140-40118162 CCTGATGTACACATGGAGCCTGG - Intergenic
1053760080 9:41345369-41345391 CCTGATGTACACATGGAGCCTGG + Intergenic
1054326644 9:63716041-63716063 CCTGATGTACACATGGAGCCTGG - Intergenic
1054538944 9:66257832-66257854 CCTGATGTACACATGGAGCCTGG + Intergenic
1054795713 9:69299763-69299785 CATTCTGCACCCATGGATCAAGG - Intergenic
1201588173 Y:15584694-15584716 CCTACTGTCCACATGGCTCTTGG - Intergenic
1202338230 Y:23832335-23832357 CCCACTGTACACATATATCTGGG - Intergenic
1202532536 Y:25837736-25837758 CCCACTGTACACATATATCTGGG + Intergenic