ID: 995037774

View in Genome Browser
Species Human (GRCh38)
Location 5:107554726-107554748
Sequence CACTATCAGTAATAACCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995037773_995037774 -1 Left 995037773 5:107554704-107554726 CCAAATACTGTGAGATCAACTTC 0: 1
1: 0
2: 1
3: 10
4: 153
Right 995037774 5:107554726-107554748 CACTATCAGTAATAACCCTATGG 0: 1
1: 0
2: 0
3: 6
4: 85
995037771_995037774 29 Left 995037771 5:107554674-107554696 CCTTTGATTATACCTAACAAATA 0: 1
1: 0
2: 0
3: 22
4: 261
Right 995037774 5:107554726-107554748 CACTATCAGTAATAACCCTATGG 0: 1
1: 0
2: 0
3: 6
4: 85
995037772_995037774 17 Left 995037772 5:107554686-107554708 CCTAACAAATATCATGTGCCAAA 0: 1
1: 0
2: 0
3: 20
4: 230
Right 995037774 5:107554726-107554748 CACTATCAGTAATAACCCTATGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995037774 Original CRISPR CACTATCAGTAATAACCCTA TGG Intronic
905153633 1:35954089-35954111 CACTACCAGTAAAAACCAAATGG + Intronic
910974216 1:92889105-92889127 AACTATTAGTAAAAAGCCTAGGG - Intronic
921969604 1:221133860-221133882 TTCTATCAGTAGTAACCGTAAGG + Intergenic
924151364 1:241133657-241133679 CCCTTTCAGTAGAAACCCTAAGG - Intronic
1068941376 10:62684447-62684469 CACTCTCAGAAGCAACCCTATGG + Intergenic
1069733644 10:70636656-70636678 CAATCCCAGTAAAAACCCTAAGG + Intergenic
1072440524 10:95450300-95450322 CACTATTACTAATAAAGCTATGG - Intronic
1075645738 10:124094681-124094703 CACTGTCAGGAATGACCCTTCGG - Intergenic
1077061741 11:620550-620572 CACAATCAGTAACACCCCTGTGG + Intronic
1079619761 11:22539453-22539475 CATCATCATTAATAACTCTATGG + Intergenic
1085242440 11:75069780-75069802 CACTATCAGAATTAACCTAAGGG - Intergenic
1087655790 11:100921458-100921480 AACCATCAGTAATCACCCTCTGG + Intronic
1093042436 12:14398664-14398686 CACAATCAGAAATAAATCTATGG - Intronic
1102269799 12:111523421-111523443 CACTATTAGAAATAATGCTATGG + Intronic
1103585382 12:121950045-121950067 CACTATTTGTAATAACCAAAAGG + Intronic
1106441582 13:29778203-29778225 CAACCTCAGTGATAACCCTAAGG + Intronic
1109772096 13:66988852-66988874 CGCAATCAGTAATAACGCTCTGG - Intronic
1111571757 13:90097146-90097168 CACTATCAGTAAGAATACTATGG - Intergenic
1116190669 14:41661577-41661599 GACTATGAGTATTAGCCCTAGGG - Intronic
1117868999 14:60178163-60178185 AAATATCAGCAATATCCCTATGG + Intergenic
1118081120 14:62361893-62361915 CACTATCCCTAATAGCCCTTAGG - Intergenic
1120614355 14:86684512-86684534 CACAATCAGAAATAAATCTAAGG - Intergenic
1124034798 15:26045305-26045327 CACCCTCAGTGATAACCCTGTGG - Intergenic
1126484847 15:49169002-49169024 CATTTACAGTAATAACCCAACGG + Intronic
1130339805 15:82990050-82990072 TTCTATCAGTAGTAACCGTAAGG - Exonic
1131376714 15:91930464-91930486 CCCAATGAGTAATAACCATATGG + Intronic
1131753910 15:95539901-95539923 CACTAGCAATATTAACCCTCTGG + Intergenic
1136693388 16:32053518-32053540 CATTTTCACTAATAAACCTATGG + Intergenic
1136793879 16:32996741-32996763 CATTTTCACTAATAAACCTATGG + Intergenic
1137850180 16:51733890-51733912 CACTTTCATAAATAACCCTATGG - Intergenic
1140118286 16:72061694-72061716 CCCTATCAGCAATAACCTTCTGG + Intronic
1203096141 16_KI270728v1_random:1258434-1258456 CATTTTCACTAATAAACCTATGG + Intergenic
1152846775 17:82605367-82605389 CATTATCAGTACTCACCCCAGGG + Intronic
1153545070 18:6196738-6196760 CTATCTCAGTAATAAGCCTAAGG + Intronic
1153747637 18:8196357-8196379 CTCTAACAGTAATAGCACTAAGG - Intronic
1153885660 18:9463220-9463242 CATTATCAGTGATAACCGTGAGG - Intergenic
1156122084 18:33857520-33857542 CACTATCAGTAAACACTCAATGG - Intronic
1156577976 18:38341030-38341052 CATAGTCAGTAATAACCATAAGG - Intergenic
1158670935 18:59473217-59473239 GACTATCAGTAGTAATCATAAGG - Intronic
1164810496 19:31151102-31151124 CATTATCAGTAATAACCACAGGG + Intergenic
1165368108 19:35382432-35382454 GACTATCATTAATGCCCCTAAGG + Intergenic
925424828 2:3740036-3740058 CACAACCACTATTAACCCTAAGG + Intronic
929530684 2:42749954-42749976 CACTATCATTAATATCCTCAGGG - Intronic
940332958 2:152495190-152495212 TACTAACAGGAATAACACTAAGG + Intronic
941000609 2:160199095-160199117 CACTATCAGAAATATCACTGAGG + Intronic
945319014 2:208400004-208400026 CCCCTTCATTAATAACCCTATGG + Intronic
948346775 2:237305332-237305354 GATTATCAGCAATAACCCTCTGG + Intergenic
1171110400 20:22475675-22475697 CACCATCAGAACTAACCCTGAGG + Intergenic
1175162232 20:57017559-57017581 CCCTGAAAGTAATAACCCTAAGG - Intergenic
1178046503 21:28700435-28700457 CACAATCAGAAATAACCATGGGG + Intergenic
1182587081 22:31350052-31350074 CACTATCCATAATAACCAAAAGG - Intergenic
952433863 3:33252656-33252678 CACTATCCATAATAACCAAAAGG - Intergenic
952511241 3:34058503-34058525 TAATATCATTATTAACCCTAGGG - Intergenic
952688164 3:36173232-36173254 CACTCTCAGTAATTCCCTTAGGG - Intergenic
953566448 3:44036060-44036082 GATTATCAGTCATATCCCTAAGG - Intergenic
955900991 3:63754279-63754301 CAATATCAGAAATAAGCATAAGG + Intergenic
959771637 3:110106047-110106069 CACTAAAAGTACTAATCCTATGG - Intergenic
963592182 3:147274831-147274853 TAATATCAGTAAAAACTCTAAGG + Intergenic
965176920 3:165346655-165346677 CACTATATGAAATAACCCTAAGG - Intergenic
969374146 4:6752177-6752199 CACTATCCATAATAGCCCAAAGG + Intergenic
973639127 4:52885958-52885980 CACTATCAGTAGTAGTCCTGAGG - Intronic
973846062 4:54914387-54914409 CACTATCAGAAATAGCCCCAGGG - Intergenic
974703704 4:65484443-65484465 GACTATCAGAAATAACACCAAGG - Intronic
975143620 4:70943150-70943172 AACCATCAGAAATGACCCTATGG - Intronic
975575633 4:75859706-75859728 CATTATTAGAAATAACACTAGGG - Intergenic
976818675 4:89179859-89179881 CAATGTGTGTAATAACCCTATGG - Intergenic
978318481 4:107466426-107466448 CAGTAACAGTAATAACCAGATGG + Intergenic
979075679 4:116266390-116266412 GACAATCAGTATTAACCCTCAGG - Intergenic
982973649 4:162023796-162023818 CATTATCAGAATTAACCATAGGG + Intronic
983424376 4:167563680-167563702 CATTATCATTAATAACCTTTGGG - Intergenic
987907215 5:24091924-24091946 CACTATGAGTAATATCTCAAGGG + Intronic
991957513 5:72010234-72010256 AATTATCACAAATAACCCTAAGG - Intergenic
993128297 5:83862425-83862447 CACAATCATTAATAAGGCTAGGG + Intergenic
993128308 5:83862526-83862548 CACAATCATTAATAAGGCTAGGG + Intergenic
995037774 5:107554726-107554748 CACTATCAGTAATAACCCTATGG + Intronic
995068362 5:107888761-107888783 CATTATCTGTAATAGCCCCAAGG - Intronic
998735441 5:145134034-145134056 CTCTATAAGTAATAAGCCTGAGG - Intergenic
999290241 5:150420265-150420287 AACTGTCATTAATAGCCCTAGGG + Intergenic
1004641529 6:17520879-17520901 CACTTTGATTAATACCCCTAAGG - Intronic
1008412841 6:51201262-51201284 AAATATCAGTAATAACCTTTTGG - Intergenic
1010426287 6:75732345-75732367 CAATATGAATAATAACACTAAGG + Intergenic
1017093963 6:150787669-150787691 CACCATCAGAAATGACCCTGTGG - Intronic
1018722730 6:166586116-166586138 TTCTATCAGTAGTAACCGTAAGG + Intronic
1038674647 8:29612754-29612776 CACTATTAGTAAAAACCTTAGGG + Intergenic
1045171850 8:99679345-99679367 CCCTCTTAGTAATAACCATAAGG - Intronic
1045316073 8:101044713-101044735 CACTACCAGGAATAAGCCTGAGG + Intergenic
1046317637 8:112528056-112528078 CATCATCAGTGATAACACTATGG + Intronic
1049034459 8:140063390-140063412 CACTTTGAGAAATAATCCTACGG + Intronic
1186370893 X:8946397-8946419 CACTTTTAGTAACAGCCCTAGGG + Intergenic
1190005507 X:46732805-46732827 TACTATAAGAAACAACCCTAGGG + Intronic
1192833073 X:74770723-74770745 AACTATCAGTCATAGCCCAATGG + Intronic
1197496055 X:127182420-127182442 CACTATCAGTATTAGTCTTATGG - Intergenic