ID: 995038248

View in Genome Browser
Species Human (GRCh38)
Location 5:107559567-107559589
Sequence GAACATAAACAGATGTAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995038248 Original CRISPR GAACATAAACAGATGTAGTT GGG (reversed) Intronic
901272372 1:7962166-7962188 GCAGAGAGACAGATGTAGTTGGG + Intronic
907898909 1:58719665-58719687 GGACATAAACAGAAGTAGGTGGG - Intergenic
909299853 1:73998659-73998681 GAACATAAACATTTGTTGTTAGG - Intergenic
909637327 1:77831148-77831170 GAAAGTAAACAGATCTTGTTTGG + Intronic
910488051 1:87737813-87737835 AAACAGAAAGAGATGGAGTTGGG + Intergenic
911785995 1:101949189-101949211 GAACATAAACAGTGGTGTTTTGG - Intronic
911816661 1:102360846-102360868 GAACATCAACACATGAATTTTGG + Intergenic
911828303 1:102516396-102516418 GAAAATAAACATATATATTTAGG + Intergenic
913075940 1:115340323-115340345 GGACAGAAATAGAGGTAGTTAGG - Intergenic
913103152 1:115588014-115588036 GAATATAAACAGTGATAGTTGGG - Intergenic
913420532 1:118663147-118663169 GAAAATAAACAGATGAATCTAGG + Intergenic
914045535 1:144088767-144088789 AAATATACACAGAGGTAGTTAGG + Intergenic
914132575 1:144871919-144871941 AAATATACACAGAGGTAGTTAGG - Intergenic
917089621 1:171339793-171339815 GAAAATAAACAGATGGCCTTGGG + Intronic
917556621 1:176096712-176096734 GAATATAAACAGTGATAGTTGGG - Intronic
917980894 1:180268356-180268378 CAAGAGAAACAGATGTAGATTGG + Intronic
921522858 1:216177920-216177942 GAAAGTCCACAGATGTAGTTTGG - Intronic
923213144 1:231824474-231824496 AAACACAAACAGATTTAGTCAGG - Intronic
923509300 1:234635785-234635807 GAAAAAAAAAAGATTTAGTTGGG - Intergenic
923832516 1:237573823-237573845 GAAAATAAAAAGATGCTGTTAGG + Intronic
924422003 1:243918297-243918319 GAAGATAAACAGGTTTAGTTGGG - Intergenic
1063829756 10:9938919-9938941 GAACATAAAAAAATGGAGCTGGG - Intergenic
1063894798 10:10668567-10668589 GAGTAAAAACAGAAGTAGTTGGG - Intergenic
1065098751 10:22311726-22311748 GAAAATAAACAAATGTAATTTGG - Intergenic
1065854144 10:29815996-29816018 GAAAATCAAAAGATGTATTTTGG + Intergenic
1068520189 10:58069060-58069082 GAAAATAAACAGTTGGAGATGGG - Intergenic
1070729782 10:78818602-78818624 GAACATCAACATATGAATTTGGG - Intergenic
1074684354 10:115946051-115946073 TAGCATTAACAGATATAGTTTGG + Exonic
1081501835 11:43674634-43674656 TAAAATAAACACATGTACTTTGG - Intronic
1086883545 11:92177182-92177204 GAACAGGAACATATGTGGTTAGG - Intergenic
1087315328 11:96595877-96595899 GAGCATAAGCAGCTGTAGTTGGG - Intergenic
1089552246 11:119288882-119288904 GAACACAAACAGATGTTTTACGG + Intronic
1090164550 11:124533673-124533695 GATCATACATAGATCTAGTTTGG - Intergenic
1090491923 11:127171548-127171570 CAACATGAACAGATGAAGTGAGG - Intergenic
1090767174 11:129886048-129886070 GAAGATAAACAGATGGATTTTGG - Intronic
1091062606 11:132477760-132477782 GAACATAGACTGATGTATTAAGG + Intronic
1095248317 12:39947510-39947532 AAACATGAACACATGTATTTAGG + Intronic
1100500837 12:95172589-95172611 GAAGATAAACAGGTATACTTTGG - Exonic
1101002278 12:100368490-100368512 GAACATCAACATATCTATTTTGG + Intronic
1102828719 12:115974588-115974610 GAATATAAGCAGTGGTAGTTGGG + Intronic
1103395162 12:120601566-120601588 AAACATAAACAAAATTAGTTGGG - Intergenic
1104039470 12:125120355-125120377 GAACAGATTCAGATGTAATTAGG - Intronic
1106743057 13:32668076-32668098 GAACTTAAACAGTTTTATTTTGG + Intronic
1107178748 13:37431242-37431264 TAACAACAACAAATGTAGTTAGG + Intergenic
1107228074 13:38075220-38075242 GAAGATAAACAGAAATATTTTGG + Intergenic
1108107476 13:47027271-47027293 GAATTAAAACAGATGAAGTTGGG + Intergenic
1108975385 13:56437215-56437237 GAAAATGGAGAGATGTAGTTTGG + Intergenic
1111132648 13:83996895-83996917 GAATATAAACAGAGATAGTTGGG - Intergenic
1111537334 13:89619900-89619922 GAACATAAATAAATTTATTTTGG + Intergenic
1111761737 13:92475107-92475129 GAAAATAAACAGTTGAAGTCAGG + Intronic
1111865807 13:93767214-93767236 GAACAGAAGCAGCTGTATTTTGG + Intronic
1111963790 13:94840044-94840066 GAAAATAAACATGTGAAGTTGGG + Intergenic
1115022439 14:28699014-28699036 GAATATAATCAAATGTAATTTGG + Intergenic
1115147414 14:30241410-30241432 GAGCATACACAGATGGGGTTAGG - Intergenic
1115228788 14:31135567-31135589 GAACAAAAACAAATGAAGATCGG + Exonic
1116020011 14:39448834-39448856 GAACAAGAACAGATGTAGCATGG - Intergenic
1116244882 14:42397088-42397110 GAAAACAAAATGATGTAGTTTGG + Intergenic
1118196246 14:63629311-63629333 GAGAATAAAGAGATGAAGTTTGG - Intronic
1118552501 14:66970992-66971014 CCACATAAACAGAAGTAATTTGG - Intronic
1118942682 14:70352768-70352790 GTACAAAAACAAATGTAGTTGGG - Intronic
1121502268 14:94447692-94447714 GAACTGAAACAAATTTAGTTGGG - Intronic
1122431538 14:101651563-101651585 AAAAATTAACTGATGTAGTTGGG - Intergenic
1122607320 14:102955495-102955517 GAACATCAACAGAGGTCGGTGGG + Intronic
1124052742 15:26213689-26213711 GAAAATGAAAAAATGTAGTTGGG + Intergenic
1124808952 15:32914932-32914954 GTAGATAAACAGATGAACTTAGG + Intronic
1125757913 15:42077455-42077477 TCACATCAACAGATATAGTTGGG + Intronic
1129950497 15:79584847-79584869 TAAACTGAACAGATGTAGTTTGG - Intergenic
1131889845 15:96961208-96961230 GAACATAGACAGACAGAGTTTGG - Intergenic
1134397751 16:13880842-13880864 GAACATAAACAGAAGTAGGTAGG - Intergenic
1140712096 16:77688173-77688195 GAAGACAAACATATTTAGTTTGG - Intergenic
1142430651 16:90024877-90024899 TAACAGAAACAGAAGTAGTTTGG - Intronic
1146801667 17:35829283-35829305 GTCCATAAATAGATATAGTTAGG + Intronic
1148985216 17:51614975-51614997 GATCAAAGACAGAGGTAGTTGGG - Intergenic
1153109131 18:1562585-1562607 GAACATAAACAAATCTACTCTGG - Intergenic
1155853529 18:30802316-30802338 AAATATAAACTGATATAGTTTGG - Intergenic
1157175763 18:45450546-45450568 GAACAGAACCAGATGAACTTAGG + Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158791908 18:60791005-60791027 GAATATAAACAGATCAATTTAGG + Intergenic
1158825908 18:61218858-61218880 GATCATTAAATGATGTAGTTGGG - Intergenic
1159242664 18:65762831-65762853 GAAAAAAAAAAGATGAAGTTGGG + Exonic
1159733487 18:72062573-72062595 GGAAATAAACAGATGTAGTCAGG + Intergenic
1159784068 18:72693082-72693104 GAATATAAACAGTGATAGTTGGG - Intergenic
1162903021 19:13806505-13806527 AAAAATAAACAAAAGTAGTTGGG + Intronic
1164144411 19:22502844-22502866 GAACTCAAACAGATGGAGATTGG - Intronic
1165141795 19:33704196-33704218 GGACACAACCAGATGTAGTGAGG - Intronic
1166826220 19:45610961-45610983 AGACATAAGCAAATGTAGTTTGG + Intronic
1202685094 1_KI270712v1_random:42174-42196 AAATATACACAGAGGTAGTTAGG + Intergenic
925477181 2:4230294-4230316 GAACATGAAAAGTTGAAGTTGGG - Intergenic
926460650 2:13125780-13125802 GGACAAAAACAGTTGGAGTTTGG - Intergenic
927261640 2:21097541-21097563 GAACACACACAGATGGACTTCGG - Intergenic
928283258 2:29966842-29966864 GTTCTTAAATAGATGTAGTTGGG - Intergenic
928960583 2:36922051-36922073 AAATATACACAGAGGTAGTTAGG + Intronic
929176125 2:38978149-38978171 GAACATAAAGGGATGAATTTAGG + Intergenic
932325841 2:70861106-70861128 GAACATAAACATTTATAGATGGG - Intergenic
933478750 2:82826218-82826240 GAAGATAAATTGATGTGGTTGGG + Intergenic
934246625 2:90312682-90312704 AAATATACACAGAGGTAGTTAGG - Intergenic
935137997 2:100324150-100324172 GAACATTAACCGATATAATTGGG - Intergenic
936720495 2:115246680-115246702 GGACACACACAGATGTTGTTGGG + Intronic
936780594 2:116028347-116028369 AAACATATACATATGTACTTAGG - Intergenic
936928128 2:117758790-117758812 CAACATAAATAGAAGTAGGTGGG - Intergenic
937845882 2:126578446-126578468 GAACATAATCATATGCACTTAGG + Intergenic
939581037 2:143946307-143946329 CAAGATAAACAGCTGTAATTCGG - Exonic
939764656 2:146231639-146231661 GATCATAAACATATGTTGTTTGG + Intergenic
939936413 2:148298846-148298868 GTATATAAACAGGTGTACTTAGG - Intronic
939937994 2:148315388-148315410 TAAAACAAACAGATGTATTTTGG - Intronic
939980929 2:148779896-148779918 GGACTTAAACAGATTTATTTGGG + Intronic
941270689 2:163423902-163423924 TAACATATAGAGATGTAGTAAGG + Intergenic
941707592 2:168676135-168676157 GGACTTAAAGATATGTAGTTGGG + Intronic
942287507 2:174435246-174435268 GCAGATAAAAAGATGTAGTCAGG + Exonic
945319489 2:208405714-208405736 GAACTTCAACATATGTATTTTGG - Intronic
947088628 2:226484691-226484713 AAACATAAACAGGTATAGATAGG + Intergenic
1168785917 20:540204-540226 CAACATAAACAGTTCTAGTTTGG - Intronic
1169151871 20:3295849-3295871 GAACATTAAAGGATGTCGTTTGG - Intronic
1169237344 20:3941777-3941799 GAAAATAAAAAGATGAAGCTGGG + Intronic
1169936968 20:10893900-10893922 GAACATAACCACGTGTAGATGGG + Intergenic
1172327796 20:34050570-34050592 GCACAGACACAGAAGTAGTTGGG - Intronic
1174898897 20:54477409-54477431 GAATATATACATATGTAATTAGG + Intronic
1177567891 21:22847443-22847465 GAATATAAACAGTGATAGTTGGG + Intergenic
1177972814 21:27811156-27811178 GAAGACAAACTCATGTAGTTTGG + Intergenic
1179554925 21:42166605-42166627 GTACATAAATATTTGTAGTTGGG - Intergenic
1181927451 22:26371470-26371492 GAATATACACAAATGTAGCTGGG + Intronic
1182188021 22:28427745-28427767 TAACATAAACATTTGTATTTGGG - Intronic
1182702504 22:32251932-32251954 GAAAATAGACAGATGTAGCTGGG + Intronic
1185353895 22:50354528-50354550 GAACACAAACATTTGTAGGTGGG + Intronic
949890716 3:8731909-8731931 AGATATAAACAGAAGTAGTTGGG + Intronic
951554649 3:23909038-23909060 CCACATAAACAGAAGTTGTTTGG + Intronic
952079987 3:29746395-29746417 GTACAAACACAGCTGTAGTTTGG - Intronic
953647972 3:44773091-44773113 GAATATAAACAGTGATAGTTGGG + Intronic
953918594 3:46936625-46936647 GGACATAGACAGATGGAGTAAGG - Intronic
954778699 3:53044298-53044320 TAAGATAAACAGATGATGTTTGG - Intronic
954870060 3:53761075-53761097 GAAGTTGAACAGATGGAGTTGGG + Intronic
955074922 3:55604576-55604598 GAACAGCAACAGATGAGGTTGGG + Intronic
956352913 3:68357803-68357825 GAACTTGAACAGGTGTAATTGGG - Intronic
956539051 3:70313719-70313741 GTACATAAAGAAATGAAGTTAGG - Intergenic
956878117 3:73483763-73483785 GAACATTCCCAGATGTATTTGGG + Intronic
957230645 3:77509921-77509943 CAGCATAAGCAGAAGTAGTTGGG + Intronic
957339988 3:78883350-78883372 GAAGACAAACAGGTGTAGTCAGG - Intronic
960230226 3:115217414-115217436 CAAAATAAAAAGATGTAGCTCGG + Intergenic
960408505 3:117292220-117292242 GAACATAAATAGATTTAGGCTGG - Intergenic
961401158 3:126644594-126644616 GGACAAAAACATATGTACTTTGG - Intronic
962851346 3:139310577-139310599 GAACATGAAAAGATGTCGCTGGG + Intronic
963423532 3:145093606-145093628 GAACACAAACATATATATTTGGG - Intergenic
963435338 3:145259074-145259096 GAATATAAACAGTGATAGTTGGG + Intergenic
964825769 3:160826274-160826296 GAACATGATGAGTTGTAGTTTGG + Intronic
965350432 3:167605487-167605509 GAAAAAAAACAGATGCAGTCTGG + Intronic
966159208 3:176950291-176950313 AAACATAAACACATGAATTTGGG + Intergenic
966268559 3:178076909-178076931 CAACAGCAACAGTTGTAGTTTGG - Intergenic
966465698 3:180228637-180228659 GAATATAAACAGTGATAGTTGGG - Intergenic
972262764 4:37427150-37427172 GAAAGTATACAGATGGAGTTTGG - Intronic
974030783 4:56774414-56774436 TAAAGTAAACAAATGTAGTTAGG + Intergenic
974075986 4:57169021-57169043 GAACCTAAGGAGAAGTAGTTGGG + Intergenic
974177477 4:58343280-58343302 GAGCATAAACAGATGTAAGGAGG + Intergenic
974400521 4:61399460-61399482 GAACCTAAAAAGATGAAATTGGG - Intronic
975091291 4:70407331-70407353 AAACATAAACACATTTATTTGGG - Intronic
976468259 4:85396185-85396207 GAACATATAGAGGTGTAGGTAGG - Intergenic
976975153 4:91157169-91157191 CAACACAAACAGATGAATTTAGG - Intronic
977142261 4:93388170-93388192 CAATATAAACACCTGTAGTTTGG - Intronic
977876374 4:102155204-102155226 AAACATAAGCAGAAGTAGCTGGG + Intergenic
978057575 4:104291391-104291413 GAGTAAAAAGAGATGTAGTTGGG - Intergenic
979410515 4:120373019-120373041 GAAAATGAACAAATATAGTTGGG - Intergenic
981978256 4:150758732-150758754 GAAAATAAAAAGAATTAGTTGGG - Intronic
984369578 4:178845583-178845605 TAACATAAAAAGATGGAGTTTGG + Intergenic
985712979 5:1440536-1440558 GAACTTCAACAGATGAACTTGGG - Intronic
987890067 5:23864779-23864801 GAATATAAACAGTGATAGTTGGG - Intergenic
989539532 5:42602814-42602836 CAATATAAACAGATGTACATTGG - Intronic
989796580 5:45481981-45482003 AAACAAAAACAAATGTAGTTGGG + Intronic
990902070 5:60762563-60762585 AAATATAAACAGAGGTGGTTTGG - Intronic
992359764 5:76025063-76025085 GAACACACACAGATGGAGTGTGG - Intergenic
992674441 5:79091879-79091901 GAACCCAAACAGATGTTGTGAGG + Intronic
992809550 5:80372998-80373020 GAACAATACCAGATTTAGTTGGG + Intergenic
992915529 5:81448629-81448651 GAACATCAACATATGTACTGAGG + Intronic
992943896 5:81790483-81790505 GAAGATAAAAAGATGTAGAGTGG + Intergenic
993597701 5:89880317-89880339 CAATATAGAGAGATGTAGTTGGG - Intergenic
993814046 5:92518664-92518686 GAGAATAAACAGATGTAGAGGGG - Intergenic
994617444 5:102122829-102122851 GAACATATACTAATGTACTTGGG - Intergenic
995038248 5:107559567-107559589 GAACATAAACAGATGTAGTTGGG - Intronic
996235111 5:121118564-121118586 GGACATAAACCAATGTAATTAGG + Intergenic
997507520 5:134429750-134429772 GAATATATACATATGTAATTTGG - Intergenic
998983545 5:147730284-147730306 GGACATACACAGATGGACTTAGG - Intronic
999371731 5:151059686-151059708 GAACAGAAGGAGATATAGTTAGG + Intronic
999545004 5:152618182-152618204 AAACATATACAGATGGAGGTGGG - Intergenic
1000269361 5:159668829-159668851 GTACATAAACATGTGCAGTTTGG - Intergenic
1000636935 5:163655251-163655273 GAACATAAACAAATAAAATTTGG - Intergenic
1000969165 5:167694921-167694943 GAATGTCAACAGAAGTAGTTTGG - Intronic
1008637583 6:53426407-53426429 TAACATATAAAGATGTAATTGGG - Intergenic
1010016754 6:71113507-71113529 AAACATGAACAGATGATGTTTGG - Intergenic
1010194686 6:73227191-73227213 GAACAGATTCAGATGAAGTTGGG - Intronic
1012080409 6:94750884-94750906 GAACATAGACTGACATAGTTTGG + Intergenic
1012124462 6:95410443-95410465 GAGAATAACCATATGTAGTTAGG - Intergenic
1014134210 6:117868805-117868827 GAACAAAAATAGATGTTCTTAGG - Intergenic
1016504444 6:144762867-144762889 GAATTTAATAAGATGTAGTTAGG + Intronic
1017084930 6:150705048-150705070 CAACATCAACATATGTATTTGGG + Intronic
1017809643 6:157975698-157975720 AAACATAAAAAGATGAAATTTGG - Intergenic
1021650381 7:22827273-22827295 GAAGATAAACAGATTTAGGGAGG - Intergenic
1022937487 7:35193863-35193885 GAATATAAAATGATGTAGTCTGG - Intergenic
1024204350 7:47143505-47143527 GGACATAAACAGATTTAATTTGG - Intergenic
1024491132 7:49986723-49986745 GAATATAAACAGTGATAGTTGGG - Intronic
1025979892 7:66396708-66396730 GAACATAAAAACCTGGAGTTTGG + Intronic
1031401716 7:121331623-121331645 GAACATAAACAGAAGTTGCCTGG + Intronic
1032619108 7:133509441-133509463 AAATATAAGCAGAGGTAGTTGGG + Intronic
1033067593 7:138171200-138171222 ACACACAAACAGATGTATTTGGG - Intergenic
1033956261 7:146852128-146852150 GAACATGAACATATGAATTTTGG + Intronic
1037334374 8:17778005-17778027 AAACAAAAACAGATGTGGGTGGG + Intronic
1039978156 8:42384436-42384458 GAAAAGAATCAGATGTAGCTGGG - Intergenic
1042347283 8:67740563-67740585 GAAAATAAATAAAAGTAGTTTGG - Intronic
1043273851 8:78368541-78368563 GTACATAAAGAGAATTAGTTGGG - Intergenic
1043771688 8:84209814-84209836 GTACACATACACATGTAGTTGGG - Intronic
1043874871 8:85474646-85474668 GAACATAAAGAGATCAACTTGGG + Intronic
1044100388 8:88128857-88128879 GCACATAAACAGACTTAGATAGG + Intronic
1048625571 8:136181388-136181410 GAACATTAACATATGAATTTTGG + Intergenic
1050265155 9:3882169-3882191 GAACATGAACTGATGCTGTTTGG - Intronic
1050579647 9:7039093-7039115 GAAAATATACTGATGAAGTTAGG - Intronic
1052198418 9:25746660-25746682 GAACTTAAACATATGAATTTAGG - Intergenic
1052616795 9:30851968-30851990 GAATATAAACAGTGATAGTTTGG - Intergenic
1054841121 9:69741305-69741327 GAAGAGAAACAGATTTAGGTAGG - Intronic
1058231077 9:102426334-102426356 AAACATAAACAGAAGTAGAAAGG + Intergenic
1058279248 9:103090980-103091002 GAACACACACACATGTAGTCTGG - Intergenic
1058933820 9:109749035-109749057 GGACATCAACAGATGAATTTTGG + Intronic
1061653449 9:132069392-132069414 GAACATAAAGACATGGAATTGGG + Intronic
1186030569 X:5365034-5365056 GAACATATAGAGGTGAAGTTGGG - Intergenic
1189586862 X:42470682-42470704 GAAAGTAAACTGATGCAGTTCGG + Intergenic
1189649964 X:43178155-43178177 GAATATAAACAGTGATAGTTGGG - Intergenic
1191189539 X:57651604-57651626 GAAAATAAACAGTGATAGTTGGG - Intergenic
1194048205 X:89035276-89035298 GAACTTCAACAGATGTAGTTAGG + Intergenic
1194224263 X:91236187-91236209 GAATAGAAACAAATGTAGTGAGG - Intergenic
1196520620 X:116667308-116667330 GAATATAAACAGTGATAGTTGGG + Intergenic
1196563095 X:117173886-117173908 GAACATAAACAGTAATAGTTGGG - Intergenic
1198939320 X:141935398-141935420 GAATATAAACAGTGATAGTTGGG - Intergenic
1201381829 Y:13388675-13388697 TAACATCCACTGATGTAGTTAGG + Intronic
1202588509 Y:26457277-26457299 AAATATACACAGAGGTAGTTAGG - Intergenic