ID: 995039016

View in Genome Browser
Species Human (GRCh38)
Location 5:107567554-107567576
Sequence CTGGGGCAGGGGTGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2642
Summary {0: 1, 1: 3, 2: 25, 3: 307, 4: 2306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995039016_995039031 22 Left 995039016 5:107567554-107567576 CCATCCACCCACCCCTGCCCCAG 0: 1
1: 3
2: 25
3: 307
4: 2306
Right 995039031 5:107567599-107567621 CACCCAAGACTCCCAAGAAAGGG 0: 1
1: 0
2: 0
3: 20
4: 222
995039016_995039030 21 Left 995039016 5:107567554-107567576 CCATCCACCCACCCCTGCCCCAG 0: 1
1: 3
2: 25
3: 307
4: 2306
Right 995039030 5:107567598-107567620 ACACCCAAGACTCCCAAGAAAGG 0: 1
1: 0
2: 0
3: 11
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995039016 Original CRISPR CTGGGGCAGGGGTGGGTGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr