ID: 995039016 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:107567554-107567576 |
| Sequence | CTGGGGCAGGGGTGGGTGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2642 | |||
| Summary | {0: 1, 1: 3, 2: 25, 3: 307, 4: 2306} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 995039016_995039031 | 22 | Left | 995039016 | 5:107567554-107567576 | CCATCCACCCACCCCTGCCCCAG | 0: 1 1: 3 2: 25 3: 307 4: 2306 |
||
| Right | 995039031 | 5:107567599-107567621 | CACCCAAGACTCCCAAGAAAGGG | 0: 1 1: 0 2: 0 3: 20 4: 222 |
||||
| 995039016_995039030 | 21 | Left | 995039016 | 5:107567554-107567576 | CCATCCACCCACCCCTGCCCCAG | 0: 1 1: 3 2: 25 3: 307 4: 2306 |
||
| Right | 995039030 | 5:107567598-107567620 | ACACCCAAGACTCCCAAGAAAGG | 0: 1 1: 0 2: 0 3: 11 4: 173 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 995039016 | Original CRISPR | CTGGGGCAGGGGTGGGTGGA TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||