ID: 995039182

View in Genome Browser
Species Human (GRCh38)
Location 5:107568986-107569008
Sequence GTCAACAGAACCAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995039182 Original CRISPR GTCAACAGAACCAAGGTGGG AGG (reversed) Intronic
907190177 1:52641615-52641637 GTCAGCAGAACCATGGAGGTTGG + Intronic
908268585 1:62401717-62401739 GACAGCAGACACAAGGTGGGTGG + Intergenic
909075688 1:71047872-71047894 GTGGACAGAACCGAGGTGGGAGG + Intergenic
909448973 1:75777739-75777761 GTGAGCTGAAGCAAGGTGGGTGG + Intronic
909514041 1:76487741-76487763 GCCAACGGAACAAAGGTGGATGG - Intronic
909720881 1:78767844-78767866 GTCCATAGAACACAGGTGGGTGG - Intergenic
911665149 1:100543437-100543459 GTCTTCAGGAACAAGGTGGGAGG + Intergenic
912771873 1:112471358-112471380 GTCAACTCAGCCAAGGTTGGCGG - Intronic
912938102 1:114021251-114021273 GGCCTCAGAACCATGGTGGGAGG - Intergenic
913203803 1:116517335-116517357 GGCCACAGACCCAAGCTGGGAGG - Intronic
913407921 1:118516796-118516818 AGCAACAGAACAAAGCTGGGCGG - Intergenic
914323513 1:146588249-146588271 CTCAGCAGAACCAGGTTGGGTGG + Intergenic
914676361 1:149909959-149909981 GACTACAGAAGCCAGGTGGGAGG - Intronic
915852774 1:159344316-159344338 GCAAAGAGAACCAAGGAGGGAGG + Intergenic
921305391 1:213791569-213791591 TGCAAAAGAAACAAGGTGGGAGG + Intergenic
921944126 1:220874850-220874872 GGCAACAAATCCAAGGTGAGTGG + Intergenic
922578006 1:226675967-226675989 GTCTAAATAACCAAAGTGGGGGG + Intronic
924186541 1:241497244-241497266 GGTAACAGAAACAAGGTTGGAGG + Intergenic
1062768920 10:84801-84823 GTCAACACACCCAAGGGGTGGGG + Intergenic
1062992526 10:1833561-1833583 GTGAAAAGAACAAAGGTGAGAGG + Intergenic
1067033195 10:42894115-42894137 GTCCTCAGAATCATGGTGGGAGG - Intergenic
1069343423 10:67439529-67439551 GACAACAGCACCAAGGGGGATGG + Intronic
1074047385 10:109851136-109851158 GTCAACAGGGCCAAGGTGAAAGG + Intergenic
1074801905 10:117008226-117008248 GGGAACAGGACCAAGGTGTGGGG + Intronic
1076643018 10:131931648-131931670 GTCACCAAAACAAAGATGGGTGG - Intronic
1078824815 11:14919215-14919237 GACAACAGTACCAAGGCGGATGG - Intronic
1079093230 11:17495021-17495043 GTCCAAAGAACCAGGGTTGGTGG - Intronic
1079156172 11:17949772-17949794 CTCAACAGAGCCAAGGAAGGTGG + Intronic
1080281089 11:30557636-30557658 GTTAACAGCACCAAGGTAGCTGG - Intronic
1083590068 11:63888577-63888599 CACACCAGAAGCAAGGTGGGAGG - Intronic
1086094260 11:83034681-83034703 TACTCCAGAACCAAGGTGGGAGG + Intronic
1087347420 11:96989597-96989619 AAAAACAGAACCAATGTGGGTGG + Intergenic
1088033468 11:105281082-105281104 GGCATCAGAATCACGGTGGGAGG + Intergenic
1088197817 11:107294810-107294832 GCCAACAGAACAAAGCTGGATGG + Intergenic
1088377788 11:109160731-109160753 GACATCAGAATCATGGTGGGAGG + Intergenic
1090220096 11:125012681-125012703 ATAAACAGAATCAAGGTGGGAGG + Intronic
1090286683 11:125505723-125505745 GTCGACAGTGCCATGGTGGGGGG + Intergenic
1090875032 11:130781360-130781382 GTCAACAAAGCCAGGCTGGGAGG + Intergenic
1090926372 11:131254096-131254118 GGCAACAGAGCCAAAGCGGGAGG + Intergenic
1091753521 12:3037353-3037375 GTCAAAAGATCCAAGGTGACGGG + Intronic
1097280147 12:57840206-57840228 TTCAGCAGATCCCAGGTGGGGGG + Intronic
1103230550 12:119326914-119326936 GGGAGCAGGACCAAGGTGGGGGG - Intergenic
1107015489 13:35705426-35705448 GTCAACAGAGCCAAGAAGAGCGG + Intergenic
1108094304 13:46884419-46884441 CTAAACAAATCCAAGGTGGGCGG + Intronic
1108172452 13:47755780-47755802 GTCACCAGAACTAGAGTGGGAGG + Intergenic
1111201877 13:84948865-84948887 GTCAACAGAAAGCAGGTGGTTGG - Intergenic
1114801767 14:25783870-25783892 AGCAACAGAACAAAGCTGGGTGG - Intergenic
1115944004 14:38639516-38639538 GTCAAAAGAACAAAGCTGGAGGG + Intergenic
1119862414 14:77946014-77946036 GTCCAGAGAACCAGGATGGGAGG - Intergenic
1120485011 14:85102405-85102427 GGCATCAGAATCATGGTGGGAGG + Intergenic
1121006572 14:90494488-90494510 ATCATCAGAAACAAGGTGGGAGG - Intergenic
1121419017 14:93799292-93799314 GCCACCAAAACCGAGGTGGGGGG - Intergenic
1125251933 15:37714383-37714405 CGGAACAGGACCAAGGTGGGAGG - Intergenic
1126481659 15:49129756-49129778 GTCAACAAAATCAAGGAGGTGGG - Intronic
1129917656 15:79288549-79288571 GTCAGCAGAAACCAGGTGTGGGG + Intergenic
1133837365 16:9378835-9378857 CTCAACAGAACCGAGATTGGAGG + Intergenic
1136354212 16:29733241-29733263 GACGACAGAACCAAGGGGGATGG + Intergenic
1140010048 16:71122600-71122622 CTCAGCAGAACCAGGTTGGGTGG - Intronic
1141433008 16:83980614-83980636 GAAAACAGAACAAGGGTGGGTGG + Intronic
1144083738 17:11787883-11787905 GGCCTCAGAACCACGGTGGGAGG - Intronic
1146623359 17:34417398-34417420 GCCAACAGAACCAGGCTGAGAGG + Intergenic
1147540988 17:41359401-41359423 GACAACAGTACCAAGGGGGATGG + Intergenic
1149240249 17:54640313-54640335 AGCAACAGAACAAAGGTGGATGG + Intergenic
1149281356 17:55108699-55108721 GTGAGCAGAAGCAGGGTGGGTGG - Intronic
1152004005 17:77665808-77665830 GTCCACAGCAGCAAAGTGGGTGG + Intergenic
1152358055 17:79815997-79816019 GTCAGCAGGGCCAAGGTGCGCGG + Intergenic
1152563338 17:81089469-81089491 GGCAACAGAACTAAGGTGGCTGG + Intronic
1152661973 17:81546692-81546714 GTCCACAGGCCCGAGGTGGGTGG + Intronic
1155827114 18:30459993-30460015 GTCAAGAGAGCAAAGGTGAGTGG - Intergenic
1159668950 18:71199506-71199528 GTCCCCAGAAACAAGGTGAGTGG + Intergenic
1163253666 19:16141836-16141858 GTCACTTGAACCAAGGTGGGCGG + Intronic
1164210241 19:23092185-23092207 GGCATCAGAATCATGGTGGGAGG - Intronic
1166120352 19:40682720-40682742 GACGACAAAACCAAGGTAGGAGG - Exonic
1166803925 19:45473756-45473778 GTCATCAGAAACAAGGCTGGGGG - Exonic
1168672883 19:58254776-58254798 GTTAATAGTACCAAGGTTGGTGG + Intronic
927685390 2:25167487-25167509 CTCAACAGAACCGGGGTGGACGG - Intronic
927856760 2:26532616-26532638 GTTGACAGAAGCAAGGTGGTAGG + Intronic
928043850 2:27907216-27907238 GTCAAGAGAAGCAAGGTCAGTGG - Intronic
931251984 2:60539938-60539960 GAGAAAAGAACCAAGGAGGGAGG + Intronic
933785385 2:85836845-85836867 GGCCTCAGAATCAAGGTGGGAGG + Intergenic
935371103 2:102347691-102347713 GTCAACTTAACTAAGATGGGAGG - Intronic
938491353 2:131762861-131762883 GTCATCAGGCCCAAGGTGGATGG - Intronic
938496209 2:131799465-131799487 GTCATCAGGCCCAAGGTGGATGG + Intronic
939026070 2:137015004-137015026 GGAAACAGAACCAAGCTGAGGGG - Intronic
940986879 2:160059737-160059759 GTCCTCAGAATCATGGTGGGAGG + Intronic
944556272 2:200890695-200890717 GGCAACAGAGGGAAGGTGGGAGG - Intronic
945929022 2:215836317-215836339 GTAAACAAAACCAAGGTGGGTGG - Intergenic
1169018619 20:2311746-2311768 GTCAACTGGAGCAAGTTGGGAGG + Intronic
1170757319 20:19215569-19215591 GCCAACAGAAGGAAGGAGGGAGG - Intronic
1170760376 20:19243869-19243891 GTCATCTGAATCAAGGTGGGTGG - Intronic
1171351267 20:24505027-24505049 GTGAACAGATCCCAGGTGTGGGG + Intronic
1171405383 20:24909363-24909385 GGCAACAGGACAAGGGTGGGTGG + Intergenic
1171791203 20:29526883-29526905 AGCAACAGAACAAAGGTGGATGG + Intergenic
1171943552 20:31354273-31354295 GTAAACAGAACCAAGGAAGAAGG + Intergenic
1173833890 20:46112598-46112620 GTCAGCAGATGAAAGGTGGGAGG + Intergenic
1174538247 20:51269414-51269436 GTCACCAGAAGAAAGGTGAGGGG + Intergenic
1174998281 20:55597380-55597402 GTGAACAGAAGCAAGGTGAATGG + Intergenic
1175101258 20:56580321-56580343 GTCAAAAAGAACAAGGTGGGTGG + Intergenic
1177118015 21:17109119-17109141 GTCCTCAGAATCATGGTGGGAGG + Intergenic
1177381420 21:20349388-20349410 GACAAAAGAAACAAAGTGGGTGG + Intergenic
1180576189 22:16777143-16777165 GTAATCCCAACCAAGGTGGGAGG - Intergenic
1182759435 22:32710284-32710306 GACAACAGCTCCAAGGTGGATGG - Intronic
1183641086 22:39092942-39092964 GCCCACAGAACGATGGTGGGAGG + Intergenic
949196820 3:1320499-1320521 GTCAGCAGAAGGAATGTGGGAGG - Intronic
949660996 3:6278376-6278398 GGCCACAGAAACCAGGTGGGAGG + Intergenic
951683865 3:25323270-25323292 GGAAATAGACCCAAGGTGGGAGG + Intronic
953089710 3:39712832-39712854 GTCAACAGAAAGCAGGTGGTTGG + Intergenic
953331837 3:42060318-42060340 GGCTACAGCACCACGGTGGGGGG + Intronic
956081108 3:65557239-65557261 ATGCACAGAACCAAGGTGGAAGG - Intronic
963070377 3:141300554-141300576 AGCAACAGAACAAAGCTGGGTGG - Intergenic
965550198 3:169956644-169956666 GCCAACAGAACCATGGTAGATGG + Intergenic
968015916 3:195332640-195332662 GTCAAGAGAGACAAGGTGGAGGG + Intronic
968473869 4:793945-793967 ATCCACAGAAACGAGGTGGGGGG - Intronic
969143040 4:5096532-5096554 TCCAACAGATCCAGGGTGGGAGG - Intronic
973181984 4:47280289-47280311 GTCAATAAAACAAAAGTGGGGGG - Intronic
973983587 4:56327726-56327748 GTCAACAGAACCAGCCTGGCTGG + Exonic
978033979 4:103972175-103972197 GTTAACAGTACCAAGATTGGTGG - Intergenic
978205208 4:106073120-106073142 AGCAACAGAACAAAGGTGGACGG - Intronic
980478756 4:133357166-133357188 GGCCACAGAATCATGGTGGGAGG + Intergenic
980626587 4:135381288-135381310 ATTAACAGAAGCAAGATGGGAGG - Intergenic
982415620 4:155128034-155128056 GGCCACAGAATCATGGTGGGAGG + Intergenic
983260844 4:165454594-165454616 GTCATCAGAACCTGTGTGGGTGG - Intronic
983696822 4:170542490-170542512 GACAACAAAAGCAAGATGGGAGG - Intergenic
985925327 5:3011552-3011574 GTCACCAAAACCAAGGTGTGAGG - Intergenic
987431413 5:17838638-17838660 GTCAACAGAAGCAAGGTCAGAGG + Intergenic
988003849 5:25383547-25383569 AGCAACAGAACAAAGCTGGGTGG - Intergenic
988416922 5:30956987-30957009 GTCAACAGAACCTGAGTGGGAGG - Intergenic
989508749 5:42259251-42259273 AGCAACAGAACAAAGGTGGATGG - Intergenic
990828571 5:59930455-59930477 ATCAACAGAAGCAAGGAGAGAGG + Intronic
990982057 5:61610816-61610838 GTCGACTGAACGAAAGTGGGCGG + Intergenic
991926008 5:71705606-71705628 GTCCTCATAACCAAGATGGGTGG - Intergenic
995039182 5:107568986-107569008 GTCAACAGAACCAAGGTGGGAGG - Intronic
995267550 5:110181037-110181059 GTGAACAGAACCATTGTGGTTGG + Intergenic
996999921 5:129747373-129747395 GTTAAGAGAGCCAAGGTGGTGGG - Intergenic
997091984 5:130869070-130869092 GGCCTCAGAACCATGGTGGGAGG + Intergenic
997420519 5:133763415-133763437 GTCAAGAAAACCAAGGAAGGAGG - Intergenic
1001240915 5:170069265-170069287 GGCAAGTGAACCACGGTGGGGGG - Intronic
1002105707 5:176878625-176878647 TTCAACATCACCAAGGTGGACGG + Exonic
1002193417 5:177490329-177490351 GTCAGATGAACCCAGGTGGGCGG + Intronic
1003414850 6:5898508-5898530 GTCAAAGAAATCAAGGTGGGTGG - Intergenic
1004896981 6:20157830-20157852 GTCAAGAGTAACAACGTGGGTGG + Intronic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007727985 6:43928333-43928355 GTCAACAGAATGTAGGTGTGAGG - Intergenic
1008779855 6:55090167-55090189 AGCAACAGAACAAAGGTGGATGG + Intergenic
1008890008 6:56477064-56477086 TTCAACAGAAACAATGTGGAAGG + Intronic
1009061076 6:58398486-58398508 GTCAAAAGAACAAAGCTGGAGGG + Intergenic
1010683036 6:78818632-78818654 ATCAACAGAACAAAGCTGGATGG + Intergenic
1013450020 6:110271154-110271176 TTCAAAAGAACCAAGATGGCTGG - Intronic
1013499310 6:110732069-110732091 AGCAAAAGAGCCAAGGTGGGTGG - Intronic
1013796672 6:113896311-113896333 CCTAACAGAGCCAAGGTGGGGGG - Intergenic
1014063492 6:117100283-117100305 AGCAACAGAACAAAGCTGGGTGG - Intergenic
1014874898 6:126645424-126645446 ATCAAAAGAAGAAAGGTGGGTGG - Intergenic
1015871368 6:137779761-137779783 GATAACAGAACGAGGGTGGGGGG - Intergenic
1017156115 6:151324056-151324078 GTCCACAGAGCCAAGGGGGCAGG - Intronic
1018490792 6:164290398-164290420 GTCCACAGAACAAAGGTGTTTGG + Intergenic
1019464053 7:1176771-1176793 CTCATCAGAAGCCAGGTGGGTGG - Intergenic
1024024808 7:45401067-45401089 TTCATCAGAACAAAGGTGAGTGG + Intergenic
1028137658 7:87239128-87239150 AGCAACAGAACAAAGCTGGGCGG + Intergenic
1029639589 7:101811454-101811476 GTCACCAGAGTCAGGGTGGGAGG + Intergenic
1031596926 7:123659384-123659406 GTCTACAGAGGCAAGGTGAGAGG - Intronic
1031988343 7:128178484-128178506 GTGAGCAGAATGAAGGTGGGTGG + Intergenic
1032924192 7:136584227-136584249 GTCAGGAGTGCCAAGGTGGGTGG - Intergenic
1033036076 7:137877504-137877526 GTGAAAAGAACCACGGTGGGGGG + Exonic
1033816187 7:145076173-145076195 GTCCTCAGAATCATGGTGGGAGG - Intergenic
1037899636 8:22680180-22680202 GTCTACAGAGCCATGGTAGGTGG + Intergenic
1037952352 8:23027644-23027666 GACAGCAGAACCTGGGTGGGTGG - Intronic
1039594915 8:38783332-38783354 TTCAGCAGACCCCAGGTGGGGGG + Intronic
1044905279 8:96994372-96994394 GTCTACAGCACCAAAGTGAGTGG + Intronic
1046982290 8:120349362-120349384 AGCAACAGAACAAAGCTGGGTGG + Intronic
1047838039 8:128715350-128715372 AGCAACAGAACAAAGGTGGATGG + Intergenic
1048488186 8:134867782-134867804 GTCAACAGAAGCAAGGGTTGTGG - Intergenic
1048521144 8:135156636-135156658 GGCAACAGAACAAAGCTGGATGG - Intergenic
1049655442 8:143794994-143795016 GACAACAGGACGGAGGTGGGGGG + Intronic
1050645423 9:7714026-7714048 AGCAACAGAACAAAGCTGGGTGG + Intergenic
1050929156 9:11302128-11302150 GACCTCAGAACCATGGTGGGAGG + Intergenic
1053206196 9:36188599-36188621 GTGGACTGAACAAAGGTGGGTGG - Intergenic
1055395823 9:75873943-75873965 GAGGACAGTACCAAGGTGGGTGG + Intergenic
1058464360 9:105213198-105213220 GACATGAGAAGCAAGGTGGGAGG - Intergenic
1058495719 9:105557423-105557445 GTTAAAAGAACCAAAGTGAGAGG + Intergenic
1059433027 9:114261059-114261081 GGCAACAGAACAAAGCTGGTGGG + Intronic
1061486624 9:130923626-130923648 GTCCACAGATCCATGGTGGAGGG + Intronic
1062041255 9:134405274-134405296 GCCCAAAGAAGCAAGGTGGGTGG + Intronic
1062232704 9:135491007-135491029 ATCGGCAGAACAAAGGTGGGAGG - Intergenic
1187645097 X:21338964-21338986 GTCCTCAGAATCATGGTGGGAGG - Intergenic
1188418648 X:29969980-29970002 GTCAACAGAAGCAAGGAGTCAGG + Intergenic
1188503819 X:30859327-30859349 GTCAACAGTGCCAAGGTTGAGGG + Intronic
1188808536 X:34622263-34622285 GTCAAGAGAACAAGAGTGGGTGG - Intergenic
1188962257 X:36507146-36507168 GACAACAGCACCAAGGAGGATGG + Intergenic
1189228910 X:39436658-39436680 GTCCTCAGAATCATGGTGGGAGG + Intergenic
1192525769 X:71842940-71842962 AGCAACAGAACAAAGGTGGAGGG - Intergenic
1193947371 X:87755089-87755111 GTTAACAGTACCAAGGTTGGTGG + Intergenic
1196964449 X:121040647-121040669 GCGAAAAGAACAAAGGTGGGGGG + Intergenic
1197640841 X:128966471-128966493 GGCAATAGAACCAAGGTAGTGGG - Intergenic
1197706470 X:129638088-129638110 GTCCAAAGCACCAAGGTGGGAGG - Intergenic
1198043301 X:132875553-132875575 GTCAGCAGAGCCAAGGTGTCTGG + Intronic
1198447209 X:136729073-136729095 AGAAACAGAACCAATGTGGGGGG - Intronic
1198635156 X:138689766-138689788 GTCAACAGAACCATGATGGGTGG - Intronic
1198995445 X:142568608-142568630 GTGAGCAGAAGCATGGTGGGTGG + Intergenic
1200148902 X:153941942-153941964 GACAGCAGAACCCAGGTGAGGGG - Exonic
1201072826 Y:10165088-10165110 ATCAACAGAACAAAGCTGGGGGG - Intergenic
1201478157 Y:14406839-14406861 GTAAAGAGACCCAAGATGGGAGG + Intergenic