ID: 995041492

View in Genome Browser
Species Human (GRCh38)
Location 5:107593291-107593313
Sequence ACTGAAGTCCGGTCCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995041492_995041495 -6 Left 995041492 5:107593291-107593313 CCAGCACAGGACCGGACTTCAGT 0: 1
1: 0
2: 0
3: 9
4: 78
Right 995041495 5:107593308-107593330 TTCAGTATCCAGGCATTCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 148
995041492_995041497 6 Left 995041492 5:107593291-107593313 CCAGCACAGGACCGGACTTCAGT 0: 1
1: 0
2: 0
3: 9
4: 78
Right 995041497 5:107593320-107593342 GCATTCTGTGGCTTTGCACCAGG 0: 1
1: 0
2: 2
3: 14
4: 168
995041492_995041499 28 Left 995041492 5:107593291-107593313 CCAGCACAGGACCGGACTTCAGT 0: 1
1: 0
2: 0
3: 9
4: 78
Right 995041499 5:107593342-107593364 GAGAACAAATCTGTTCTTTCTGG 0: 1
1: 0
2: 0
3: 22
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995041492 Original CRISPR ACTGAAGTCCGGTCCTGTGC TGG (reversed) Intronic
903948216 1:26977703-26977725 CCTGAAGTCCTGTCCTGGGCAGG - Intergenic
907557713 1:55359168-55359190 CCTGAAGGCCTGTCCTATGCAGG + Intergenic
908751613 1:67429830-67429852 ACAAAAGTCCGGTCCTGCGAAGG - Intronic
909605247 1:77501260-77501282 ACTGAAGACCAGTCCAGAGCTGG + Intronic
912498458 1:110106431-110106453 ACCTAAGTCCTGCCCTGTGCTGG - Intergenic
914080759 1:144409635-144409657 ACAGAACTACGGTCCTGTCCAGG + Intergenic
914530392 1:148519638-148519660 ACAGAACTACGGTCCTGTCCAGG + Intergenic
1068073121 10:52220730-52220752 AATGAAATCCTGTCCTCTGCAGG - Intronic
1069910003 10:71753115-71753137 AATGGAGTCCGGAGCTGTGCAGG - Intronic
1071141385 10:82513268-82513290 AATGAAGTCATGTCCTTTGCAGG - Intronic
1073477878 10:103766235-103766257 ACTGTGGTCCTGACCTGTGCAGG + Intronic
1074733425 10:116401858-116401880 AATGCAGTCAGGTTCTGTGCTGG - Intergenic
1075023484 10:118967634-118967656 CCTGAAGTCCGGTGCTGGGGTGG + Intergenic
1075486645 10:122827925-122827947 ACTGTAGTCCCATCCTGTGCAGG - Intergenic
1076195262 10:128513165-128513187 TCTGAACCCTGGTCCTGTGCTGG + Intergenic
1079071662 11:17352540-17352562 ATTGAAGGCCTGCCCTGTGCAGG + Intronic
1081793304 11:45804157-45804179 ACTGAAGCCGGGTCCCGGGCGGG + Intronic
1084022135 11:66424068-66424090 ACTGAAGTCCAGTTCTTTGGAGG - Exonic
1084437762 11:69154339-69154361 ACTGAGGGCTGGTCCTGGGCGGG + Intergenic
1089173379 11:116531684-116531706 ACTGAGGTCTAGTTCTGTGCTGG - Intergenic
1092061770 12:5556875-5556897 GCTGAGATCCGTTCCTGTGCTGG + Intronic
1093495145 12:19748022-19748044 AATGAAGTCATGTCCTTTGCAGG - Intergenic
1100467027 12:94855441-94855463 ACAAAAGTCCTGTCCTGGGCAGG + Intergenic
1103764165 12:123269985-123270007 CCTGAAGTCCTGTTCTGGGCTGG - Intronic
1107396645 13:40024993-40025015 CCTGGTGTCCAGTCCTGTGCAGG - Intergenic
1114706490 14:24732318-24732340 AATGAAATCAGGTCCTTTGCAGG + Intergenic
1118443728 14:65833839-65833861 ACTGAAGTCCTGTACTATGCAGG + Intergenic
1120975837 14:90247590-90247612 AAAGAAGTCCTGTCCTGTACAGG + Intergenic
1122994779 14:105257110-105257132 AGCGAAGACAGGTCCTGTGCGGG - Intronic
1128708710 15:69856358-69856380 ACTGAGGGCTGGTCCTGTGTGGG - Intergenic
1128758151 15:70197010-70197032 ACTGGTGTCAGGTCCTCTGCTGG - Intergenic
1130068454 15:80626635-80626657 ACTGAAATCCTGCCCTGTGCAGG + Intergenic
1133781131 16:8940358-8940380 GCTGGAGGCTGGTCCTGTGCTGG - Intronic
1134104391 16:11475632-11475654 TCTGAGGTCCAGTCCTGTACTGG - Exonic
1137249738 16:46732794-46732816 ACTGAAGTCAGCTCCTGCCCTGG - Intronic
1141469631 16:84229609-84229631 CCTGCAGGCCGGGCCTGTGCTGG - Intronic
1145919413 17:28599199-28599221 ACAGAAGACCGGTCCTGGGCCGG - Exonic
1151007604 17:70455853-70455875 AATGAAGTCATGTCCTTTGCAGG - Intergenic
1152911365 17:83006760-83006782 ACAGTAGTCAGGTCCTGTGCTGG + Intronic
1154072163 18:11162457-11162479 ACTCATGTCCGGTCTAGTGCAGG + Intergenic
1160143104 18:76343388-76343410 ACAGAAGTCAGGCCCTTTGCTGG - Intergenic
1160292994 18:77610963-77610985 TCTGAAGTCGGTTCCTCTGCAGG - Intergenic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1161300368 19:3539543-3539565 TCTGAAATCCAGGCCTGTGCGGG + Intronic
1165299094 19:34956794-34956816 TCTGAAGGCCAGTGCTGTGCTGG - Exonic
934885514 2:98021126-98021148 ACTGCAGCCTGGTCCTGGGCAGG - Intergenic
937017371 2:118618498-118618520 TCTGAACTCCGGCCGTGTGCAGG + Intergenic
937604117 2:123775847-123775869 AATGAAGTCATGTCCTTTGCAGG - Intergenic
938193206 2:129301148-129301170 ACTGAGGTGGGTTCCTGTGCAGG + Intergenic
940546578 2:155096406-155096428 ACTGATGTCAGGTACTGTCCAGG - Intergenic
1171284993 20:23929729-23929751 GCTGAATTCCAGTCCTGTGTTGG + Intergenic
1173795868 20:45859293-45859315 TCTGAAGTCCAGTGCTATGCTGG + Intronic
1181527218 22:23496893-23496915 ACTGAACTCCTGTCCTGAGCTGG - Intergenic
968952291 4:3701433-3701455 AGTGGAGCCCGGTCATGTGCAGG - Intergenic
969936781 4:10690019-10690041 GCTGAAGTCATGTCCTCTGCTGG + Intergenic
973129336 4:46630762-46630784 AATGAAGTCATGTCCTTTGCAGG - Intergenic
973634905 4:52852762-52852784 ACTGTAGTCCTGTCCAGCGCAGG - Intergenic
978407401 4:108394898-108394920 ACAGAAGGCCTGTCCTGTGGGGG - Intergenic
982938570 4:161518887-161518909 TCTGAAGGCTTGTCCTGTGCTGG + Intronic
983855945 4:172645089-172645111 ACAGAAGTCCAGTCCTTTGTTGG + Intronic
989297515 5:39847239-39847261 AATGAAGTCATGTCCTTTGCAGG - Intergenic
990258716 5:53998536-53998558 ACAGAAGTCCCTTTCTGTGCAGG - Intronic
994017145 5:94980450-94980472 ATTGAATTCCAGTGCTGTGCTGG - Intronic
995041492 5:107593291-107593313 ACTGAAGTCCGGTCCTGTGCTGG - Intronic
1000110438 5:158103105-158103127 AATGAGATCCGGTCCTTTGCAGG - Intergenic
1006058722 6:31404110-31404132 CCTGAAGTCCTGTCCTCTCCCGG + Intronic
1006071207 6:31498995-31499017 CCTGAAGTCCTGTCCTCTCCCGG + Intronic
1009754588 6:67920221-67920243 AATGAAGTCATGTCCTTTGCAGG + Intergenic
1009961561 6:70528999-70529021 ACTGAGCTCAGGTCCTTTGCAGG - Intronic
1010209044 6:73348614-73348636 AATGAACACCGGTGCTGTGCTGG - Intergenic
1013270086 6:108537362-108537384 AATGAAGACGGGTGCTGTGCTGG + Intergenic
1018582471 6:165318866-165318888 AATGAAGTCATGTCCTTTGCAGG - Intergenic
1024704129 7:51938763-51938785 TCTGAAGTCTGGGGCTGTGCAGG + Intergenic
1026063123 7:67044527-67044549 ACTGAAGGCCCATCCTGTGCTGG + Intronic
1035241346 7:157531801-157531823 AATGAAGTCATGTCCTTTGCAGG - Intergenic
1037705149 8:21311543-21311565 ACTGAAATCCAGTCCGGGGCTGG + Intergenic
1037894651 8:22643818-22643840 CAGGAAGTCCGGTGCTGTGCTGG - Intronic
1042138489 8:65655431-65655453 ACATATGTCCGATCCTGTGCTGG + Intronic
1044717396 8:95113095-95113117 ACTGAAGTTCAGTGATGTGCCGG + Intronic
1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG + Intergenic
1060876619 9:127088693-127088715 TCTGTAGTCCTGTCCTGTCCTGG + Exonic
1061237938 9:129352880-129352902 CCTGAAGCCAGGACCTGTGCAGG - Intergenic
1061259474 9:129471924-129471946 ACTTAACTCCTGTCCTGAGCCGG + Intergenic
1186090205 X:6038649-6038671 AGTGAAGTTTGGTCCTGTTCAGG - Intronic
1188790763 X:34405457-34405479 ACTCAAGTCAGTTCCTGTGCTGG + Intergenic
1190744458 X:53313741-53313763 ACTGCACACAGGTCCTGTGCAGG + Intronic
1190910942 X:54772176-54772198 AATGAAATCCTGTCCTTTGCAGG + Intronic
1191110872 X:56802460-56802482 ACTGAAGTCTGACTCTGTGCAGG - Intergenic