ID: 995045328

View in Genome Browser
Species Human (GRCh38)
Location 5:107640216-107640238
Sequence GAGATTAGCCATCCTGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995045328_995045329 6 Left 995045328 5:107640216-107640238 CCAGGAACAGGATGGCTAATCTC 0: 1
1: 0
2: 1
3: 8
4: 122
Right 995045329 5:107640245-107640267 AATATATGCAGCCCTTGACAAGG 0: 1
1: 0
2: 0
3: 7
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995045328 Original CRISPR GAGATTAGCCATCCTGTTCC TGG (reversed) Intronic
900547025 1:3234921-3234943 GAGGCTGGCCATCCTTTTCCAGG + Intronic
903289104 1:22296713-22296735 TGGATTAGCCACCCTATTCCAGG + Intergenic
903728607 1:25472055-25472077 GAGATTATCTTCCCTGTTCCTGG - Intronic
906078631 1:43069317-43069339 GACAATCCCCATCCTGTTCCTGG - Intergenic
914457189 1:147847105-147847127 GAGATTAAACAGCTTGTTCCTGG - Intergenic
914922891 1:151859556-151859578 CAGATTAGCCATTTTTTTCCTGG + Intergenic
921136133 1:212260815-212260837 GAAATTAGCGATCCTTTCCCAGG + Intergenic
921790348 1:219282953-219282975 GAAATTATCCATCCTTTTCTTGG + Intergenic
921863355 1:220062657-220062679 GAGTTTAGCCATCCCATTACTGG - Intronic
922384890 1:225073024-225073046 TAGAGTAGCCATCCTGTGCTGGG + Intronic
923460416 1:234205317-234205339 GAAAGAAGCCATTCTGTTCCTGG - Intronic
924287846 1:242506673-242506695 GAGATGAGCTTTACTGTTCCTGG - Intronic
1064325670 10:14349172-14349194 CAGAATAGCCATGGTGTTCCTGG - Intronic
1068874414 10:61981070-61981092 GAGATTAAGCAACCTGTTCAAGG - Intronic
1070426422 10:76292542-76292564 GAGATTTGCCATTATATTCCTGG - Intronic
1070635869 10:78126648-78126670 GAGATTACCCAGCCTGTCCTAGG - Intergenic
1071202101 10:83230398-83230420 CCGATTTGCCATCCTGTCCCAGG + Intergenic
1073789561 10:106926929-106926951 GAGTTTATCCATCCAGTTACTGG + Intronic
1079060618 11:17245695-17245717 GAGGTTAGGCATCCTGCTCAAGG - Intronic
1087999314 11:104856005-104856027 GACATTAGTCATCCTGTGCTTGG + Intergenic
1088036182 11:105318728-105318750 GGCAGTAGTCATCCTGTTCCTGG + Intergenic
1089500364 11:118928465-118928487 GAGATTAGGCATCCCGTTGCCGG + Intronic
1090257232 11:125293416-125293438 GAGATTGGCTCTCCTGTCCCTGG + Intronic
1094522444 12:31207079-31207101 GAGAATCGCCATCCTTTTCCAGG + Intergenic
1106552670 13:30785399-30785421 GGGATTAGCCAACCCCTTCCTGG - Intergenic
1107815057 13:44237319-44237341 GGAATTTGCCATCCTGTTGCAGG + Intergenic
1109024355 13:57140564-57140586 GAAATTAGTCATCCTGAACCGGG - Intergenic
1109025342 13:57147134-57147156 GAAATTAGTCATCCTGAACCGGG - Intronic
1109026332 13:57153707-57153729 GAAATTAGTCATCCTGAACCGGG - Intronic
1109027324 13:57160278-57160300 GAAATTAGTCATCCTGAACCGGG - Intergenic
1109028310 13:57166843-57166865 GAAATTAGTCATCCTGAACCGGG - Intergenic
1109029297 13:57173414-57173436 GAAATTAGTCATCCTGAACCGGG - Intergenic
1110421919 13:75320676-75320698 CAGATTAGGCATCCATTTCCAGG - Intronic
1112193125 13:97197458-97197480 GAGATTATCAATACTGTTCCAGG - Intergenic
1114461767 14:22890924-22890946 GGCATGAGCCATCCTGTGCCTGG - Intergenic
1115697481 14:35914971-35914993 GAGGTTAGTCTTCCTGTTTCAGG + Intronic
1116065097 14:39972195-39972217 GAAATTAGTCATTCTGTTTCAGG - Intergenic
1116757920 14:48970985-48971007 GAGATTAGCCATCATGATTATGG + Intergenic
1118100346 14:62593077-62593099 GAGATGAGTCATCCTTTTTCTGG + Intergenic
1202906417 14_GL000194v1_random:76163-76185 GTGATTGGCCCACCTGTTCCTGG + Intergenic
1126532323 15:49724869-49724891 GAGAGAATCCCTCCTGTTCCAGG - Intergenic
1126947798 15:53843551-53843573 GAGATTAGTAATGCTGTTCAAGG + Intergenic
1126970289 15:54103393-54103415 AATATTATTCATCCTGTTCCAGG - Intronic
1128540206 15:68523103-68523125 GAGTATAGCCATCCAGGTCCAGG + Intergenic
1128542281 15:68544482-68544504 GATGGTATCCATCCTGTTCCAGG + Intergenic
1130894503 15:88159765-88159787 GAGATTCTCCATCAAGTTCCAGG - Intronic
1137397211 16:48124592-48124614 CAGAATAGCCTTCCTGTTCAAGG - Intronic
1139506724 16:67401743-67401765 GAGACTAGCCATGCTGTCCCTGG - Intronic
1140884004 16:79226959-79226981 AAGGTTCCCCATCCTGTTCCTGG - Intergenic
1141279061 16:82614172-82614194 CAGCTAAGCCATCCTGTTCCTGG + Intergenic
1143563712 17:7709331-7709353 GAGAGTCGCCACCCTGGTCCTGG + Exonic
1146225684 17:31064223-31064245 GTTATTAGGAATCCTGTTCCAGG + Intergenic
1148536298 17:48441922-48441944 GAGATTTCCCAACCTTTTCCAGG + Intergenic
1159688368 18:71453030-71453052 GAGAATGGCCATACTCTTCCTGG + Intergenic
1168180142 19:54656671-54656693 GAGATTTGTCTTTCTGTTCCTGG + Intronic
1168481195 19:56721511-56721533 GATATTTGCCTTCCTGTGCCTGG - Intergenic
926692587 2:15747827-15747849 GGGATTAGCCCTACTTTTCCGGG + Intergenic
927677526 2:25117253-25117275 GAGATTCCCCAGCCTCTTCCAGG + Intronic
928242549 2:29599358-29599380 GAGAGTTGCCATCCTACTCCTGG - Intronic
929899516 2:45988775-45988797 GAGACTAGCGATGCTGCTCCTGG - Intronic
932753370 2:74387207-74387229 GAGATTGTCAATCCTTTTCCTGG + Intronic
936640951 2:114312499-114312521 GAGATTAACCATCCACTGCCCGG + Intergenic
940111570 2:150160669-150160691 GGGAGAAGCCATCCTGTTCATGG + Intergenic
946970878 2:225089746-225089768 TGTATTAGACATCCTGTTCCTGG + Intergenic
947239897 2:227983164-227983186 GAAATTAGCATTCCAGTTCCTGG - Intronic
947746788 2:232512078-232512100 AAGATTAGCCCTCCTGTCCTTGG + Intergenic
948157487 2:235795173-235795195 GAGATTACCCAGCCTGCTGCTGG + Intronic
948485841 2:238280194-238280216 GAGCTTAGCCATTCAGTTCCTGG - Intronic
948600356 2:239104419-239104441 GAGTTTTGCCATGTTGTTCCAGG + Intronic
1171235622 20:23521955-23521977 GAGAATCTCCTTCCTGTTCCAGG - Intergenic
1173411014 20:42809360-42809382 AAGAGCAGCCATCCTGATCCGGG - Intronic
1175701766 20:61143445-61143467 GACATTAGCCCTTCTGTGCCTGG + Intergenic
1176120316 20:63451644-63451666 GAGGGTGGCCATGCTGTTCCAGG + Intronic
1176625762 21:9090962-9090984 GTGATTGGCCCACCTGTTCCTGG + Intergenic
1178935341 21:36857161-36857183 GAGATAAGCAATCCTGATACGGG - Intronic
1182097036 22:27633009-27633031 GCAATTAGCCAGCCTGTGCCCGG - Intergenic
949109860 3:246457-246479 GAAATCAGCCATCAGGTTCCAGG + Intronic
950257114 3:11514477-11514499 GAGATGTGGCTTCCTGTTCCAGG + Intronic
952862428 3:37824504-37824526 GAGGTTAGGCATCCTGTCACAGG - Intergenic
957602522 3:82356392-82356414 GTGATTAGTCATGATGTTCCTGG - Intergenic
958533864 3:95370187-95370209 GATATTTGGCTTCCTGTTCCTGG + Intergenic
961455364 3:127021196-127021218 GAGTGCTGCCATCCTGTTCCTGG + Intronic
962627884 3:137245146-137245168 GAGGTTAAGCATCCTGTTCAAGG - Intergenic
964546716 3:157842105-157842127 AAAAATATCCATCCTGTTCCTGG - Intergenic
964663357 3:159145877-159145899 TAAATTTTCCATCCTGTTCCAGG - Intronic
970156584 4:13148452-13148474 AAGATTAACCATGCTTTTCCAGG - Intergenic
975825978 4:78320085-78320107 GGGATTCCCCATCATGTTCCAGG - Intronic
977458120 4:97288805-97288827 GAGATTTGTCATTCTGTACCTGG + Intronic
981632600 4:146837739-146837761 GATTTTAACCATCCTGATCCTGG - Intronic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
987681018 5:21136143-21136165 AAAATTTGCCATCCTGTTTCTGG + Intergenic
988541103 5:32111040-32111062 CAAATTAGCCACCCTTTTCCAGG + Intergenic
988989135 5:36652067-36652089 GAGCTTTGCCATGCTTTTCCTGG + Intronic
995045328 5:107640216-107640238 GAGATTAGCCATCCTGTTCCTGG - Intronic
997481130 5:134185374-134185396 CATATTAGCCATACTGTTCCTGG - Intronic
1003712459 6:8607923-8607945 GAGATTAACAATACAGTTCCTGG + Intergenic
1006453794 6:34120684-34120706 GAGGTTGGCTATCCTGCTCCTGG - Intronic
1010342159 6:74766280-74766302 GAGATGAGAAATCCTGTTTCTGG - Intergenic
1017663349 6:156695376-156695398 GAGTTTAGGCAACCTGTTCAAGG - Intergenic
1022214159 7:28241560-28241582 GAGTTTAGCAATGCTGTTTCAGG + Intergenic
1026026190 7:66745573-66745595 GAGTTTTGCCATCTTGATCCAGG - Intronic
1028870076 7:95761148-95761170 GAAATTAAACAACCTGTTCCTGG + Intergenic
1029045618 7:97625120-97625142 GACATTAGCCATCTTGGTGCTGG + Intergenic
1032511140 7:132473323-132473345 CAGATTCTCCCTCCTGTTCCTGG + Intronic
1038335229 8:26640640-26640662 GAGTTTAGCCATCATGTTCCAGG - Intronic
1042069048 8:64910620-64910642 GAGATTAGACATGCAGTTGCTGG - Intergenic
1045044060 8:98257625-98257647 GAGAATCTCCATCCTTTTCCAGG + Intronic
1047613978 8:126547681-126547703 GAGACCAGCTTTCCTGTTCCCGG + Intergenic
1048901297 8:139040175-139040197 GAAAGTGGGCATCCTGTTCCAGG - Intergenic
1049064336 8:140301066-140301088 GAGAAGAGCCATCCTGGGCCAGG - Intronic
1049259436 8:141630906-141630928 GACCTTACCCATGCTGTTCCAGG - Intergenic
1049259465 8:141631041-141631063 GACATTTCCCATGCTGTTCCAGG - Intergenic
1049259671 8:141632122-141632144 GACATTTCCCATGCTGTTCCAGG - Intergenic
1049259854 8:141633087-141633109 GACCTTACCCATGCTGTTCCAGG - Intergenic
1049259886 8:141633248-141633270 GACATTTCCCATGCTGTTCCAGG - Intergenic
1049260066 8:141634213-141634235 GACCTTACCCATGCTGTTCCAGG - Intergenic
1049260098 8:141634374-141634396 GACATTTCCCATGCTGTTCCAGG - Intergenic
1054963341 9:70994171-70994193 GAGATTAGGTATCTTGTTCAAGG - Intronic
1055573857 9:77643604-77643626 AGAATTAGCCATCATGTTCCTGG - Intronic
1057776863 9:98018423-98018445 GAGTTGAGTCGTCCTGTTCCTGG + Intergenic
1058424855 9:104867367-104867389 GATATTAGCCATCCTTTACCGGG - Intronic
1058458508 9:105160629-105160651 GACATTTACCCTCCTGTTCCAGG + Intergenic
1060246050 9:121947026-121947048 CAGATTAAAGATCCTGTTCCAGG + Intronic
1061185210 9:129049026-129049048 GAGAGTACCCATTCTGTGCCAGG - Intronic
1061980675 9:134101751-134101773 CAGCTTTGCCATCCTGTACCTGG - Intergenic
1203748936 Un_GL000218v1:61383-61405 GTGATTGGCCCACCTGTTCCTGG + Intergenic
1185980809 X:4775506-4775528 GGGCTTAGACAACCTGTTCCAGG + Intergenic
1186600389 X:11030447-11030469 GGGATTAGAAATCCTATTCCTGG + Intergenic
1190593911 X:52033887-52033909 GAGATTAGATAACCTTTTCCCGG + Intergenic
1195555110 X:106212679-106212701 GAGAGCAGCCTCCCTGTTCCTGG + Intergenic
1197032763 X:121837802-121837824 GAGATTATCTTTTCTGTTCCTGG - Intergenic
1201162294 Y:11176389-11176411 GTGATTGGCCCACCTGTTCCTGG + Intergenic