ID: 995049132

View in Genome Browser
Species Human (GRCh38)
Location 5:107682544-107682566
Sequence CATTGTGCACAGCATGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995049129_995049132 21 Left 995049129 5:107682500-107682522 CCTCTTCTAGTTCAATTGCTTTC No data
Right 995049132 5:107682544-107682566 CATTGTGCACAGCATGTAGTAGG No data
995049130_995049132 -1 Left 995049130 5:107682522-107682544 CCATTATCTCTCCAAAGCTTAGC No data
Right 995049132 5:107682544-107682566 CATTGTGCACAGCATGTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995049132 Original CRISPR CATTGTGCACAGCATGTAGT AGG Intergenic
No off target data available for this crispr