ID: 995051320

View in Genome Browser
Species Human (GRCh38)
Location 5:107708030-107708052
Sequence CTCAGTCATTTTTACAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995051320_995051321 12 Left 995051320 5:107708030-107708052 CCTAATTTGTAAAAATGACTGAG No data
Right 995051321 5:107708065-107708087 AAATACAACAAAAGAGTATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995051320 Original CRISPR CTCAGTCATTTTTACAAATT AGG (reversed) Intergenic
No off target data available for this crispr