ID: 995053361

View in Genome Browser
Species Human (GRCh38)
Location 5:107731561-107731583
Sequence ATGATGTTTCTGTTGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995053359_995053361 -9 Left 995053359 5:107731547-107731569 CCTGGCTAAGTTTTATGATGTTT No data
Right 995053361 5:107731561-107731583 ATGATGTTTCTGTTGAAACAGGG No data
995053358_995053361 -4 Left 995053358 5:107731542-107731564 CCATGCCTGGCTAAGTTTTATGA No data
Right 995053361 5:107731561-107731583 ATGATGTTTCTGTTGAAACAGGG No data
995053354_995053361 30 Left 995053354 5:107731508-107731530 CCTCCTGAGTAGCGAGGACTACT No data
Right 995053361 5:107731561-107731583 ATGATGTTTCTGTTGAAACAGGG No data
995053357_995053361 -1 Left 995053357 5:107731539-107731561 CCACCATGCCTGGCTAAGTTTTA 0: 67
1: 3402
2: 43603
3: 110111
4: 192502
Right 995053361 5:107731561-107731583 ATGATGTTTCTGTTGAAACAGGG No data
995053355_995053361 27 Left 995053355 5:107731511-107731533 CCTGAGTAGCGAGGACTACTCTT No data
Right 995053361 5:107731561-107731583 ATGATGTTTCTGTTGAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995053361 Original CRISPR ATGATGTTTCTGTTGAAACA GGG Intergenic
No off target data available for this crispr