ID: 995053976

View in Genome Browser
Species Human (GRCh38)
Location 5:107738603-107738625
Sequence CTGTAGATATGCAGAAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995053972_995053976 19 Left 995053972 5:107738561-107738583 CCTGCCGCTTTCTGAACCTTTGA No data
Right 995053976 5:107738603-107738625 CTGTAGATATGCAGAAGACATGG No data
995053975_995053976 3 Left 995053975 5:107738577-107738599 CCTTTGAGGCTGCACAATTCTCT No data
Right 995053976 5:107738603-107738625 CTGTAGATATGCAGAAGACATGG No data
995053974_995053976 15 Left 995053974 5:107738565-107738587 CCGCTTTCTGAACCTTTGAGGCT No data
Right 995053976 5:107738603-107738625 CTGTAGATATGCAGAAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995053976 Original CRISPR CTGTAGATATGCAGAAGACA TGG Intergenic
No off target data available for this crispr