ID: 995053976 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:107738603-107738625 |
| Sequence | CTGTAGATATGCAGAAGACA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 995053972_995053976 | 19 | Left | 995053972 | 5:107738561-107738583 | CCTGCCGCTTTCTGAACCTTTGA | No data | ||
| Right | 995053976 | 5:107738603-107738625 | CTGTAGATATGCAGAAGACATGG | No data | ||||
| 995053975_995053976 | 3 | Left | 995053975 | 5:107738577-107738599 | CCTTTGAGGCTGCACAATTCTCT | No data | ||
| Right | 995053976 | 5:107738603-107738625 | CTGTAGATATGCAGAAGACATGG | No data | ||||
| 995053974_995053976 | 15 | Left | 995053974 | 5:107738565-107738587 | CCGCTTTCTGAACCTTTGAGGCT | No data | ||
| Right | 995053976 | 5:107738603-107738625 | CTGTAGATATGCAGAAGACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 995053976 | Original CRISPR | CTGTAGATATGCAGAAGACA TGG | Intergenic | ||
| No off target data available for this crispr | |||||