ID: 995063297

View in Genome Browser
Species Human (GRCh38)
Location 5:107834911-107834933
Sequence AAGCCCTCCCAGAAGAGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995063293_995063297 -9 Left 995063293 5:107834897-107834919 CCTAGCAGCCCCAGAAGCCCTCC No data
Right 995063297 5:107834911-107834933 AAGCCCTCCCAGAAGAGCTATGG No data
995063291_995063297 -7 Left 995063291 5:107834895-107834917 CCCCTAGCAGCCCCAGAAGCCCT No data
Right 995063297 5:107834911-107834933 AAGCCCTCCCAGAAGAGCTATGG No data
995063292_995063297 -8 Left 995063292 5:107834896-107834918 CCCTAGCAGCCCCAGAAGCCCTC No data
Right 995063297 5:107834911-107834933 AAGCCCTCCCAGAAGAGCTATGG No data
995063290_995063297 0 Left 995063290 5:107834888-107834910 CCACTCTCCCCTAGCAGCCCCAG No data
Right 995063297 5:107834911-107834933 AAGCCCTCCCAGAAGAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995063297 Original CRISPR AAGCCCTCCCAGAAGAGCTA TGG Intergenic
No off target data available for this crispr