ID: 995064215

View in Genome Browser
Species Human (GRCh38)
Location 5:107841906-107841928
Sequence CATCTTACCCTGCTTCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995064215_995064218 1 Left 995064215 5:107841906-107841928 CCCTTCAGAAGCAGGGTAAGATG No data
Right 995064218 5:107841930-107841952 TTAGGTTTATTCCAGTGAGCTGG No data
995064215_995064219 2 Left 995064215 5:107841906-107841928 CCCTTCAGAAGCAGGGTAAGATG No data
Right 995064219 5:107841931-107841953 TAGGTTTATTCCAGTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995064215 Original CRISPR CATCTTACCCTGCTTCTGAA GGG (reversed) Intergenic
No off target data available for this crispr