ID: 995066247

View in Genome Browser
Species Human (GRCh38)
Location 5:107866496-107866518
Sequence GATATGGCTGCCGCTCTTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 44}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995066247 Original CRISPR GATATGGCTGCCGCTCTTAA CGG Intronic
903357731 1:22758411-22758433 GATATGGCAGCCCGTCGTAAGGG + Intronic
918082013 1:181214961-181214983 GACATGGCTCCTGCTCTCAAGGG - Intergenic
920663125 1:207935413-207935435 GAAATGCCTGCCCCTTTTAAGGG - Intergenic
922070730 1:222190592-222190614 GATAGGGCTGATGCTCTTATAGG + Intergenic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
1070681374 10:78451616-78451638 GATTTGGCTGCTGCTCTGCAGGG + Intergenic
1082983758 11:59148072-59148094 GACATGGCTGCTGCCCTCAATGG + Intronic
1090027966 11:123183846-123183868 GGTGTGGCTGCCACTCATAATGG + Intronic
1097400344 12:59120844-59120866 GATATGGCCCCTGCTCTCAATGG + Intergenic
1108963332 13:56264226-56264248 CTTATGTCTGCCGCTTTTAAGGG + Intergenic
1116957029 14:50935232-50935254 GAAATGGCTGTCCCTCTGAATGG - Intronic
1118303722 14:64637174-64637196 GATAAGGCTGAAGCTATTAAAGG - Intergenic
1119501711 14:75134109-75134131 GATGTGGCTGCGGCTGTAAAAGG + Exonic
1121910732 14:97790123-97790145 GACATGTCTGCCTCTCTTACTGG - Intergenic
1129693896 15:77729675-77729697 GATATGGCTCCCGCTCCTCCAGG + Intronic
1139233050 16:65305555-65305577 TATATGCATGCTGCTCTTAATGG - Intergenic
1148941230 17:51213506-51213528 GATATGGATACTGCTCTTAGGGG + Intronic
1153819682 18:8822796-8822818 GATGTGGCTGCTGCTGTGAACGG - Intronic
932113768 2:69025976-69025998 GAAATGGCTGCCCATTTTAATGG - Intronic
933695484 2:85214135-85214157 GATGTGGCTGTGGCTCTTCACGG - Intronic
938124911 2:128664560-128664582 GAGATGGCTGCCGCTCCTCTAGG + Intergenic
940528947 2:154854915-154854937 GTTATGGCTGGTGCTATTAAAGG - Exonic
1177291139 21:19112923-19112945 AATTTGGCTGTTGCTCTTAATGG - Intergenic
954210063 3:49091456-49091478 GATGTGGCTGCCTTTCTTTAAGG - Intronic
973552136 4:52046768-52046790 GAAATGACTGCAGGTCTTAAAGG + Intergenic
987533096 5:19146122-19146144 CATATGGCTACCTCTCTCAAAGG - Intergenic
992981785 5:82182729-82182751 GAAATGGCTGTGGCTATTAAAGG + Intronic
995066247 5:107866496-107866518 GATATGGCTGCCGCTCTTAACGG + Intronic
996492303 5:124111974-124111996 CAAATGGCTGCTGCACTTAAAGG - Intergenic
1007597337 6:43059651-43059673 GGTGTGGCTGCCGCTCTTGCCGG - Exonic
1016750439 6:147625605-147625627 GATAAGGCTGCAGGTATTAAGGG - Intronic
1017682168 6:156874922-156874944 GATGTGGCTCCTGCTCTTAAGGG - Intronic
1018239539 6:161759569-161759591 GAAATGGCTGCCACTCTGATAGG - Intronic
1026739336 7:72969097-72969119 GACAGGGCTGCCGCCCTTGAAGG - Intronic
1026790361 7:73327712-73327734 GACAGGGCTGCCGCCCTTGAAGG - Intronic
1027104395 7:75395976-75395998 GACAGGGCTGCCGCCCTTGAAGG + Intronic
1028901173 7:96101886-96101908 GAGATTGGTGCCACTCTTAAAGG + Intronic
1040436500 8:47396796-47396818 GATGTGACTGCCTTTCTTAATGG + Intronic
1044942868 8:97361068-97361090 GATATGGCCGCTGCTCTAACAGG + Intergenic
1049854992 8:144856059-144856081 GATATTGCTCCTGCTCTCAAAGG + Intergenic
1189198650 X:39173149-39173171 AATATGGCTGCAGCTAATAAAGG - Intergenic
1189251549 X:39604180-39604202 GATATGGCTGCAGCCCATCAGGG + Intergenic
1189376442 X:40470182-40470204 GATATGGTTCCCTCTCTTTAAGG - Intergenic
1196925122 X:120626328-120626350 GATATGGCTGTTACTTTTAATGG - Exonic
1199010416 X:142752034-142752056 AATTTGGCTGGCGGTCTTAAAGG + Intergenic
1199125084 X:144108508-144108530 GAAATGGCTCCAGCTCTTATTGG - Intergenic