ID: 995073232

View in Genome Browser
Species Human (GRCh38)
Location 5:107949321-107949343
Sequence CCTCCCTACTTGCCTTAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995073232_995073239 17 Left 995073232 5:107949321-107949343 CCAATTTAAGGCAAGTAGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 995073239 5:107949361-107949383 ATGTTATATATGAAAGTTAAGGG No data
995073232_995073238 16 Left 995073232 5:107949321-107949343 CCAATTTAAGGCAAGTAGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 995073238 5:107949360-107949382 AATGTTATATATGAAAGTTAAGG 0: 1
1: 0
2: 2
3: 25
4: 448
995073232_995073241 24 Left 995073232 5:107949321-107949343 CCAATTTAAGGCAAGTAGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 995073241 5:107949368-107949390 ATATGAAAGTTAAGGGACCTGGG 0: 1
1: 0
2: 2
3: 15
4: 164
995073232_995073240 23 Left 995073232 5:107949321-107949343 CCAATTTAAGGCAAGTAGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 995073240 5:107949367-107949389 TATATGAAAGTTAAGGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995073232 Original CRISPR CCTCCCTACTTGCCTTAAAT TGG (reversed) Intronic
904101654 1:28034854-28034876 CTTCCCTGCTTTCCTGAAATGGG - Intronic
905801616 1:40847681-40847703 CCTTCCTACCTGCCTTCGATTGG - Intergenic
907680779 1:56561153-56561175 CCTCCTCTCTTGCCTTAAAGAGG - Intronic
909145601 1:71926666-71926688 CTTCCCTACTTGTCTTTCATTGG + Intronic
909915754 1:81316900-81316922 GCTCCCTAGATGCCCTAAATCGG - Intronic
918767720 1:188510351-188510373 CCCCTCTACTTGGCTTACATAGG - Intergenic
921960979 1:221034096-221034118 CCTCCCCACTTGCCCTTAATGGG - Intergenic
1068508932 10:57938920-57938942 CCTCCCTCCCTTCCCTAAATTGG + Intergenic
1070068387 10:73060746-73060768 GCTCCCCACTGGCCTAAAATGGG + Intronic
1070728843 10:78811010-78811032 CCACCCTACCTGCATCAAATAGG + Intergenic
1080321123 11:31010452-31010474 CTTTCCTACTGGCCTTAAAGGGG - Intronic
1080481666 11:32657688-32657710 CCTCCCTACTAACCACAAATTGG + Intronic
1084898510 11:72293092-72293114 CATCCCTCCTTGCCTTGAAGGGG + Exonic
1087607935 11:100399769-100399791 CCTCCATAATGGCCTTTAATTGG - Intergenic
1091668940 12:2438689-2438711 GCTCCCTTCTGCCCTTAAATGGG - Intronic
1096199651 12:49672628-49672650 CCTCCCTCCTTGGCTTGACTGGG - Intronic
1098149711 12:67534151-67534173 CTACCCTACTTGCCTTACAAAGG + Intergenic
1101386449 12:104262273-104262295 GCTTCCTACTTGCCTTAGAACGG - Intronic
1103774011 12:123351990-123352012 TCTGTCTACTTGCTTTAAATTGG - Intronic
1105701201 13:22936905-22936927 CCTCCCTTCTTCCCTTAAAGTGG + Intergenic
1105854033 13:24359960-24359982 CCTCCCTTCTTCCCTTAAAGTGG + Intergenic
1108900713 13:55404308-55404330 CCACCCTATTTGCCATAGATAGG - Intergenic
1113511539 13:110859074-110859096 TCTCACTACATGCTTTAAATGGG + Intergenic
1116127372 14:40805503-40805525 CCTACTTACTTGCTTTAAATTGG - Intergenic
1117295453 14:54375008-54375030 CTTCCCTAGTTGTATTAAATGGG + Intergenic
1121562546 14:94885891-94885913 GCTCCCTCCTTGCCAGAAATGGG + Intergenic
1122330351 14:100907985-100908007 CCTCCCTCCTTGCCTTGCACTGG - Intergenic
1122842824 14:104474976-104474998 CCTCCCTTCTCCCCTTAAAGTGG + Intronic
1123910099 15:24957194-24957216 ACTGCATACTTTCCTTAAATGGG + Intronic
1127829879 15:62741261-62741283 CCTCCCTACTCATCTTAAAGTGG - Intronic
1129668411 15:77592640-77592662 CCTCCCTCCCTGCCTTTACTTGG - Intergenic
1130302165 15:82688608-82688630 CCTTCCTACCTGCCTAAAATTGG - Intronic
1132288491 15:100683130-100683152 CCTCCATCCTTGCCCTAAAGAGG - Intergenic
1134200222 16:12191807-12191829 CCTCCCTTCTTGCCTTTTATTGG + Intronic
1136379662 16:29887277-29887299 CCTCCCTACTTCCCTGAGGTGGG + Intronic
1142903278 17:3026515-3026537 CCACCCTCCTTGCATTAAAACGG + Intronic
1146515269 17:33484282-33484304 CTTCCCTATATGCCTTGAATTGG - Intronic
1148656904 17:49291258-49291280 CCTCCCTACCTGTCTTTTATGGG - Intronic
1150657545 17:67050112-67050134 CCTGCCTCCTTGCCCTAAAGAGG - Intronic
1153359882 18:4182264-4182286 TCTCTCTATTTGCCTAAAATTGG + Intronic
1158033827 18:53000370-53000392 CCTCATTACTTGCCTTGAAATGG + Intronic
1167534981 19:50044230-50044252 CCTCCCTACCTCCCTCAACTTGG - Intronic
927110062 2:19858252-19858274 CCTCCCTACTAGCCACACATCGG - Intergenic
930522790 2:52488904-52488926 CCTCTCTACTTGCCTGTTATTGG + Intergenic
935498923 2:103814523-103814545 ACAACCTACTTGCCTTGAATTGG + Intergenic
935500558 2:103833079-103833101 CCTCACTACTTGCCATATTTAGG - Intergenic
936922486 2:117703031-117703053 GCTCCCTTCTGGCCTTAACTAGG - Intergenic
938673302 2:133605228-133605250 CCTCCTTGCTCGCTTTAAATTGG + Intergenic
940172775 2:150846602-150846624 CCTTCCTTCTTGCCTTTGATGGG + Intergenic
944074249 2:195709769-195709791 CATACCTAATTGACTTAAATAGG + Intronic
944992334 2:205252678-205252700 TCTGCCTACTTGGCTTAACTTGG - Intronic
946045728 2:216819434-216819456 CCTCCCTTCTTTCCTGGAATGGG + Intergenic
946311826 2:218886389-218886411 CCTCCCTCTTTGACTTGAATGGG + Intronic
1175121184 20:56717379-56717401 CCTCCCTACTTGCCCTTGAAGGG - Intergenic
1177505188 21:22011070-22011092 GCTTTCTACTTGCCTTAGATTGG + Intergenic
1178188601 21:30254554-30254576 CCTCCTTACTTTCCTGCAATAGG + Intergenic
1179874249 21:44259619-44259641 CCTCCCTGCCTACCTTACATGGG + Exonic
1182883288 22:33752363-33752385 CCTCCCTCCTTTTGTTAAATTGG + Intronic
952999517 3:38919721-38919743 CCTCCCTAGTTATGTTAAATTGG - Intronic
957525138 3:81370939-81370961 CCTCTCTACTTGCCATCAAGAGG - Intergenic
958425055 3:93970283-93970305 CCTCACCACATGCCTTAAGTGGG + Intronic
965012812 3:163117072-163117094 CCTTGCTACTTGCCCTATATAGG - Intergenic
969235621 4:5863447-5863469 CCGCCCTGCTTCCCTTATATAGG + Intronic
971851046 4:31986771-31986793 GTTCCCTCCTTGTCTTAAATAGG + Intergenic
972917639 4:43901124-43901146 CATCCCTAATGGCCTCAAATCGG - Intergenic
986876866 5:12122059-12122081 CCTGCCTACTTCCCTGACATGGG - Intergenic
995040767 5:107585399-107585421 CTTTCCTGCTTGCCTTGAATTGG - Intronic
995073232 5:107949321-107949343 CCTCCCTACTTGCCTTAAATTGG - Intronic
995512522 5:112922709-112922731 TCTCCCTCTTTGCCTTAACTTGG + Intergenic
997275361 5:132582636-132582658 TTTCCTTTCTTGCCTTAAATGGG + Intronic
998403231 5:141858899-141858921 CCACCCTAGCTGCCTTGAATGGG - Intronic
998888993 5:146726268-146726290 ACTCCCTAGTTGGCTTAAATTGG - Intronic
999320715 5:150613419-150613441 CCTGCCTTCTTGCCTTCACTGGG + Intronic
1003506061 6:6741214-6741236 CTTGCCTAATTGCCTTTAATTGG + Intergenic
1008559804 6:52712795-52712817 TCTCCCTTCTTTCCTTACATAGG - Intergenic
1011385218 6:86789291-86789313 CCTCCCCACTTCCCCCAAATAGG - Intergenic
1011946959 6:92917087-92917109 CCTCCTGACTTACATTAAATAGG + Intergenic
1013268528 6:108523758-108523780 TCTACCTGCTTGCCTTAATTAGG - Exonic
1013953434 6:115812698-115812720 CCATCCTATTTGCTTTAAATAGG + Intergenic
1014282158 6:119453515-119453537 CTTCCATACAGGCCTTAAATAGG + Intergenic
1024504223 7:50147917-50147939 TCTCTCTACTTTCCTCAAATGGG + Intronic
1030252816 7:107466439-107466461 CTTCCCTACTTCACCTAAATTGG - Intronic
1031540293 7:122987436-122987458 CCTCCATACATACCTTAAATAGG - Intergenic
1031562286 7:123253224-123253246 CCACCCAAATTGCCTTATATTGG + Intergenic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1033427801 7:141261273-141261295 TCTTCCTATTTGCCTCAAATTGG + Intronic
1037233110 8:16684317-16684339 CCTCTCTCCTTGCTTTGAATTGG - Intergenic
1038701151 8:29850364-29850386 CCTCCCTAATTTCCTTTAACTGG - Intergenic
1041031507 8:53740677-53740699 CCTTTCTACCTGCCTAAAATAGG - Intronic
1044971349 8:97623240-97623262 CCTCCATCCTTTTCTTAAATTGG - Intergenic
1050362999 9:4848429-4848451 CTACCCTACATGCCTTAAAAAGG + Intronic
1055512866 9:77012426-77012448 CCTCCCTCGTTTCCTTAAAAAGG - Intergenic
1056188357 9:84159810-84159832 GATCTATACTTGCCTTAAATAGG + Intergenic
1062286509 9:135775326-135775348 CCTCCCAACTCGCCCTACATCGG + Exonic
1185873877 X:3686317-3686339 CCTGCCTACGTGTCTTCAATGGG - Intronic
1189021057 X:37340444-37340466 CCTCCCCACTTGCCTTTCAAAGG - Intergenic
1197361444 X:125508649-125508671 CATCCCTATTTGCCATAGATAGG - Intergenic
1197727961 X:129788683-129788705 CCTTCCTTCTTGCATCAAATAGG - Intronic
1199276049 X:145943563-145943585 CCACCATACTGGCCTTAAAAAGG - Intergenic