ID: 995074314

View in Genome Browser
Species Human (GRCh38)
Location 5:107963745-107963767
Sequence CACATTTAGCTCTGGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995074310_995074314 15 Left 995074310 5:107963707-107963729 CCTCCATTTACTATAAAATACAA 0: 1
1: 0
2: 2
3: 66
4: 1167
Right 995074314 5:107963745-107963767 CACATTTAGCTCTGGGAGCATGG 0: 1
1: 0
2: 1
3: 7
4: 156
995074311_995074314 12 Left 995074311 5:107963710-107963732 CCATTTACTATAAAATACAATAA 0: 1
1: 1
2: 8
3: 109
4: 1001
Right 995074314 5:107963745-107963767 CACATTTAGCTCTGGGAGCATGG 0: 1
1: 0
2: 1
3: 7
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995074314 Original CRISPR CACATTTAGCTCTGGGAGCA TGG Intronic
900146722 1:1161852-1161874 CATAATGAGCTCTGGGAGCTCGG - Intergenic
902739063 1:18421773-18421795 CAGTTTTGGCTCTGTGAGCAGGG + Intergenic
903319489 1:22533760-22533782 CACATGTGGGTTTGGGAGCATGG + Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
1063835367 10:10005902-10005924 CACTTTTGGCTCTGGAGGCAGGG + Intergenic
1063953325 10:11244078-11244100 CCCATCTAGCTCTGGCAGCAGGG + Intronic
1064576488 10:16751238-16751260 CACGTGTTGCTTTGGGAGCAGGG - Intronic
1066415155 10:35214702-35214724 CCCATGCAGGTCTGGGAGCATGG - Intergenic
1069825798 10:71254356-71254378 CACAAATGGCTCTGGGACCATGG + Intronic
1070121791 10:73584516-73584538 CACATTTAGCTCTGAGAAACAGG - Intronic
1072613291 10:97033245-97033267 CACATTCAGCTCCTGGAGAATGG + Intronic
1073131724 10:101193338-101193360 CACATTTAGGGAGGGGAGCAAGG + Intergenic
1074406616 10:113184994-113185016 TACATTTAGCTGTGGGGTCATGG + Intergenic
1075304118 10:121352445-121352467 CACATTTAACTCTAGGAACGTGG - Intergenic
1083204082 11:61137532-61137554 CATATTAAGCACTGTGAGCATGG - Intronic
1083723557 11:64616299-64616321 CACATGTACCTCTGTGAGCCTGG + Intronic
1085463014 11:76706631-76706653 CCCACTTAGCTCTGGCATCAGGG - Intergenic
1085690042 11:78657161-78657183 CACATCTGGCTTTGGGAGAAAGG + Exonic
1095934425 12:47661404-47661426 CACATTTTGTTTTTGGAGCAGGG - Exonic
1096426121 12:51504718-51504740 CATCTGTAGTTCTGGGAGCAAGG + Intronic
1099232021 12:80038033-80038055 CAAATTTTCCTCTGGGACCAAGG - Intergenic
1101057659 12:100935662-100935684 GACAGTGAGCTCTGAGAGCAGGG + Intronic
1101478112 12:105070686-105070708 CACATTTAGCTCTGCACCCACGG + Exonic
1102881291 12:116487039-116487061 CACATGTTCCTCTGGGAGTAGGG - Intergenic
1103832639 12:123792390-123792412 GACAATGAGCTCTGGGAGGAAGG - Intronic
1104482731 12:129122218-129122240 CACATTCAGCTCTGGAAGGAAGG - Intronic
1105058106 12:133122246-133122268 CACTTTGAGCTCTGGGTGAATGG + Intronic
1106388517 13:29312162-29312184 AAGATTTCTCTCTGGGAGCATGG - Intronic
1111485627 13:88895554-88895576 CAGAGTGAGCACTGGGAGCAGGG - Intergenic
1111741290 13:92208328-92208350 CCCATATAGGTCTGGGAGAAAGG - Intronic
1111792264 13:92872360-92872382 CAAATTTAGCTCTAGTAGTAAGG + Intronic
1114622848 14:24108026-24108048 CACATTTGGCTATGGAAGCTAGG + Intronic
1115544609 14:34454680-34454702 CAGATCAAGCTCTGGGAGTACGG - Intronic
1116862721 14:50007493-50007515 CATAGTTACCACTGGGAGCAGGG - Exonic
1117305141 14:54466695-54466717 AACTTTTAGCTCTGGGTGAAGGG - Intergenic
1117395200 14:55302061-55302083 CAAATGTAGCTCTAGCAGCAAGG + Intronic
1117409046 14:55433649-55433671 TATATTTAGCTCTGGGAAGATGG - Exonic
1119085922 14:71738838-71738860 CACTCTAAGCTCAGGGAGCAGGG - Intronic
1122672411 14:103382871-103382893 CAGAGTTAGCTGTGGGAGGATGG - Intergenic
1127235116 15:57041232-57041254 CAAATTTAGCTCTGAGTGCTGGG + Intronic
1128502299 15:68235092-68235114 CACATTAAGCACTGAGATCAGGG - Intronic
1129714478 15:77839220-77839242 CTCATTTAACTCTGTGAGGAAGG - Intergenic
1130270528 15:82444120-82444142 CACAGTTAGCTCTAGGCACATGG + Intergenic
1130439910 15:83943054-83943076 CACATTTAGCTGTGGGAGACTGG + Exonic
1130462872 15:84171439-84171461 CACAGTTAGCTCTAGGCACATGG + Intergenic
1130489802 15:84423348-84423370 CACAGTTAGCTCTAGGCACATGG - Intergenic
1130501393 15:84502098-84502120 CACAGTTAGCTCTAGGCACATGG - Intergenic
1132186335 15:99804901-99804923 CACAGTTAGCTCTCGGCACATGG + Intergenic
1132429342 15:101747805-101747827 CACAGTTAGCTCTCGGCACATGG - Intergenic
1133673942 16:8051855-8051877 CACATTTTTCTCTGAGTGCATGG - Intergenic
1133941898 16:10316358-10316380 TACATTTATCTCAGTGAGCAGGG - Intergenic
1134121008 16:11585432-11585454 CACATTTAGTTCCCAGAGCAAGG + Intronic
1135709253 16:24701058-24701080 AACATTCAGTTCTGGGAGGAAGG + Intergenic
1137014851 16:35364448-35364470 CACAATCCTCTCTGGGAGCAGGG - Intergenic
1137803287 16:51280690-51280712 CACATTTTTCTCTGTGACCATGG + Intergenic
1140214957 16:72999897-72999919 CAGATTCAGCTCTAAGAGCAGGG + Intronic
1140293866 16:73689265-73689287 CACATTATGCTCTGGGGACAGGG + Intergenic
1140315538 16:73893026-73893048 CACATTTAGGTCTTTGTGCAGGG - Intergenic
1142182198 16:88676740-88676762 CTCAGTGGGCTCTGGGAGCAAGG + Intergenic
1144033374 17:11341996-11342018 CACATTGGCCTCTGGGAGGATGG - Intronic
1144797897 17:17904873-17904895 CACCTTTCCCTCTGGGACCATGG + Intronic
1147647393 17:42041919-42041941 CACATCCTGCTCTGAGAGCATGG + Intronic
1148239010 17:45987885-45987907 CACATTTAGTGCTGGGGGCAGGG + Intronic
1151364297 17:73607090-73607112 CACATTTCTCCCAGGGAGCATGG - Intronic
1203163281 17_GL000205v2_random:71275-71297 CACAATTAGCCCAGGGGGCAGGG - Intergenic
1154388190 18:13914274-13914296 CACAAAGAGCTGTGGGAGCAGGG - Intronic
1154491472 18:14925432-14925454 CACATTCGGCTCTGGGAGAGTGG + Intergenic
1157289891 18:46401835-46401857 CACATGTAGCTCTGGTTGAAGGG + Intronic
1157761638 18:50269624-50269646 CATATTTAACTCTGTGAGGAAGG + Exonic
1159303490 18:66609268-66609290 CACATATATATGTGGGAGCATGG - Intergenic
1160252082 18:77211374-77211396 AACATTTATTTCTGGGATCAAGG + Intergenic
1160991034 19:1860409-1860431 CACATTTGGCCCTGGGAGCAGGG - Intronic
1161425435 19:4200243-4200265 AACATTGAGACCTGGGAGCAGGG - Intronic
1162367758 19:10259605-10259627 CACATTTAGGCCTGGGGGCGGGG - Exonic
1163799193 19:19354781-19354803 GCCAGCTAGCTCTGGGAGCAGGG + Intronic
928267859 2:29827170-29827192 CAGAGGCAGCTCTGGGAGCATGG + Intronic
929709093 2:44248199-44248221 CACACTTAGCTGTAGGTGCAAGG + Intergenic
931914642 2:66940386-66940408 CACATTTATGTTTTGGAGCATGG + Intergenic
935577877 2:104729563-104729585 CACAGTGAGCTCTGAGAGAAAGG - Intergenic
937295719 2:120808703-120808725 CACATCTAGGTGTAGGAGCAGGG + Intronic
938327842 2:130425090-130425112 CACATTTTGCTCCGGTTGCAGGG + Intergenic
938362105 2:130696388-130696410 CACATTTTGCTCCGGTTGCAGGG - Intergenic
940810228 2:158234437-158234459 CTCATTTACCTCTGGTAGGAGGG + Intronic
946984022 2:225251109-225251131 CACATTTCACTCTGGCAGGATGG + Intergenic
1176000019 20:62827477-62827499 CCCATGTGGCTCTGGGAGAACGG - Intronic
1176970465 21:15259634-15259656 GATATTTTGCTCTTGGAGCATGG - Intergenic
1179784423 21:43721363-43721385 CACATTCAGCTATGTGAACAAGG - Intronic
1180985317 22:19900877-19900899 CACAGCCACCTCTGGGAGCAGGG - Intronic
1182511765 22:30825057-30825079 CATGCTTAGATCTGGGAGCAGGG - Intronic
1182847831 22:33446190-33446212 CACATCCAGGTCTGGGAGGATGG + Intronic
1183795499 22:40113730-40113752 CCCATCCAGCTCTGTGAGCAGGG - Intronic
951180383 3:19652611-19652633 TACCTCTAGCTCTGGGAGTAGGG + Intergenic
952028683 3:29114417-29114439 CACATTTTGCTTTGGGAACAGGG + Intergenic
957231542 3:77523770-77523792 CACAGTTAGCAGTGGGAGAAAGG - Intronic
964944913 3:162209443-162209465 TACATTTTGCTATGGGAGAAAGG + Intergenic
966047059 3:175565101-175565123 CCCATTTAGCTAAGGGAACAAGG - Intronic
966154530 3:176901735-176901757 AACAGTTAGCTCTGGGGGCAGGG + Intergenic
967604601 3:191430665-191430687 CACCTGTAGGTCTGGGAGGAGGG + Intergenic
968004806 3:195235208-195235230 CACAGTTAGAGCTGGGAGGATGG - Intronic
968294164 3:197560806-197560828 CACATTTATCTCAGTGAGCAGGG - Intronic
968487913 4:872761-872783 CACAATGAGGTCTGTGAGCAGGG + Intronic
968973280 4:3807554-3807576 AACATTTCCCTCTGGCAGCAGGG + Intergenic
969065926 4:4480996-4481018 CAAAGGGAGCTCTGGGAGCATGG + Intronic
970492441 4:16588229-16588251 CAGATTTAGCACTGTGATCAGGG + Intronic
970507982 4:16752312-16752334 CCCATTTTGCTCAGAGAGCAAGG - Intronic
970638197 4:18033278-18033300 CACATTCAGCTCTAGAATCATGG + Intergenic
971198200 4:24489083-24489105 CACTTTCAGCTCTGGGATCCTGG - Intergenic
972420601 4:38882826-38882848 CACATTTGCCTCAGGCAGCAAGG + Intronic
974083634 4:57237215-57237237 CACTTTTAGCTCTGTGACCCTGG - Intergenic
977021924 4:91770408-91770430 CACATTTGGATCTGGTAACAAGG + Intergenic
977050443 4:92122609-92122631 CAAATTTACCTCTGAGAACAAGG + Intergenic
980438227 4:132809174-132809196 AACATTTTGATATGGGAGCAGGG + Intergenic
993538386 5:89117195-89117217 CACAGTCAGCTCAGGGGGCAGGG + Intergenic
994025496 5:95077425-95077447 CACATTTAGCTTTTGAATCAAGG + Intronic
995074314 5:107963745-107963767 CACATTTAGCTCTGGGAGCATGG + Intronic
995193040 5:109339920-109339942 CAAATTTTGTTCTGGGAGAAGGG + Intronic
997512561 5:134463580-134463602 CACATTTAGCTCTGTCTGTAAGG - Intergenic
1003058131 6:2841465-2841487 CACAAACAGCTCTGGGAGGAAGG + Intronic
1003570530 6:7253647-7253669 CACATTTATATGTGGGAGCTTGG + Intergenic
1004800576 6:19142529-19142551 CATATTTAAGTCTGGGAACAAGG - Intergenic
1007804492 6:44430175-44430197 AACCTTTAGATGTGGGAGCAAGG + Intronic
1009509366 6:64529418-64529440 CACAATTAAGTCTGGGAGAATGG - Intronic
1011339271 6:86294733-86294755 GATGTTTAGCTCTGGGACCATGG - Intergenic
1014563251 6:122916689-122916711 CTCATTAAGCTAGGGGAGCAAGG - Intergenic
1019340480 7:506706-506728 CACAGTTAGCTCTTGGTGCCTGG - Intronic
1020236998 7:6363987-6364009 GACATTTTGCACTGGAAGCATGG - Intergenic
1022630630 7:32081138-32081160 TACATTTAGCTAAGGCAGCAGGG - Intronic
1023027955 7:36068853-36068875 CACATTTCGCTCTTGTAGAAAGG - Intergenic
1024451212 7:49545532-49545554 CACATGTGGTTCTTGGAGCAAGG + Intergenic
1024719169 7:52115724-52115746 TACATTTATCTCAGAGAGCAGGG - Intergenic
1027381841 7:77619125-77619147 GCCATTTAGCTCTGGGATCTAGG + Intronic
1032236453 7:130128200-130128222 CACATTTCTCTCTGTGAGAATGG + Intronic
1036110984 8:5902111-5902133 CACAGTAAGCCCAGGGAGCATGG + Intergenic
1036631339 8:10518078-10518100 CACATTGAGCCCTGGGCTCAGGG + Intergenic
1039142328 8:34403742-34403764 CACAGTTTGCTCTGTGAGCTGGG + Intergenic
1039344805 8:36692081-36692103 CACCTTTTGCTGTGGAAGCAAGG + Intergenic
1041471011 8:58208981-58209003 TACATTTATCCTTGGGAGCATGG + Intergenic
1041477162 8:58279181-58279203 CTCATCTAGACCTGGGAGCAGGG + Intergenic
1041992338 8:64008521-64008543 CACACTTATCTCTGGGGGAAGGG - Intergenic
1042655804 8:71094908-71094930 CAGATTTAGATCGTGGAGCATGG - Intergenic
1043141159 8:76592008-76592030 CACATGTAGTTCTGGGTGCCTGG - Intergenic
1045979357 8:108166795-108166817 GTCATTTACCTCTGGGGGCAGGG + Intergenic
1046586302 8:116152733-116152755 CTCATTGAAATCTGGGAGCAGGG - Intergenic
1047597610 8:126394704-126394726 CACATTGAGGCCTGGGAGGAAGG - Intergenic
1047695550 8:127400347-127400369 CACATTTGGCCCTGGAATCAGGG - Intergenic
1049794337 8:144489577-144489599 CACATGAAGCTCTGGGAGGGAGG - Intronic
1052569675 9:30203461-30203483 CCCATTTAGCTCTGGTAGTGAGG - Intergenic
1055825978 9:80325356-80325378 CACATTTAGGCTTAGGAGCAAGG + Intergenic
1057477251 9:95413233-95413255 TTCATTTACATCTGGGAGCAGGG + Intergenic
1058204234 9:102083256-102083278 TACATTTAACTCTGGTAGCCTGG - Intergenic
1062109368 9:134773613-134773635 AACATTTATCTCTTGAAGCAGGG + Intronic
1203423462 Un_GL000195v1:16328-16350 CACAATTAGCCCAGGGGGCAGGG - Intergenic
1186387020 X:9120322-9120344 CACACTTAGCTCTGAGATCTTGG + Intronic
1187103012 X:16214373-16214395 CACAGCCAGCTATGGGAGCAGGG - Intergenic
1188452168 X:30319115-30319137 CAAATGTAGCCCTGGGAACAAGG + Intergenic
1190268407 X:48843647-48843669 CCCATTTAGCTCTCAGATCATGG - Intergenic
1191753420 X:64568198-64568220 CAGAAATAGGTCTGGGAGCATGG + Intergenic
1192320509 X:70086797-70086819 CACACTATGCTCTGGGCGCATGG + Intergenic
1195534036 X:105990514-105990536 TACATTTATCTCAGTGAGCAAGG - Intergenic
1195615536 X:106909277-106909299 CACTTTTAGCTCTGTGACCCTGG - Intronic
1197068884 X:122269262-122269284 CACAGTTAGCTATGGGACCTAGG + Intergenic
1197256609 X:124270024-124270046 CACATTTCCCTCTAGGGGCAAGG + Intronic
1198957850 X:142151296-142151318 CACATGTACTTCTGGGAGAATGG - Intergenic
1202372316 Y:24207158-24207180 CACAGTTAGCTCTAGGCACATGG - Intergenic
1202498469 Y:25462962-25462984 CACAGTTAGCTCTAGGCACATGG + Intergenic