ID: 995077124

View in Genome Browser
Species Human (GRCh38)
Location 5:107999017-107999039
Sequence CAGCAGACCTGGAGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 285}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995077124_995077134 20 Left 995077124 5:107999017-107999039 CCCATTTCCCTCCAGGTCTGCTG 0: 1
1: 0
2: 1
3: 25
4: 285
Right 995077134 5:107999060-107999082 GTGCCAGCTCCAGGTGACTTGGG 0: 1
1: 0
2: 1
3: 12
4: 173
995077124_995077136 23 Left 995077124 5:107999017-107999039 CCCATTTCCCTCCAGGTCTGCTG 0: 1
1: 0
2: 1
3: 25
4: 285
Right 995077136 5:107999063-107999085 CCAGCTCCAGGTGACTTGGGAGG 0: 1
1: 0
2: 2
3: 27
4: 488
995077124_995077133 19 Left 995077124 5:107999017-107999039 CCCATTTCCCTCCAGGTCTGCTG 0: 1
1: 0
2: 1
3: 25
4: 285
Right 995077133 5:107999059-107999081 AGTGCCAGCTCCAGGTGACTTGG 0: 1
1: 1
2: 1
3: 17
4: 209
995077124_995077131 11 Left 995077124 5:107999017-107999039 CCCATTTCCCTCCAGGTCTGCTG 0: 1
1: 0
2: 1
3: 25
4: 285
Right 995077131 5:107999051-107999073 TTGCCATCAGTGCCAGCTCCAGG 0: 1
1: 0
2: 3
3: 19
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995077124 Original CRISPR CAGCAGACCTGGAGGGAAAT GGG (reversed) Intronic
900535931 1:3177524-3177546 CAGCAGCCCTGGAGGGAAGGTGG - Intronic
901013842 1:6216428-6216450 TCGCAGACCTGGAGTGAAGTGGG - Intronic
902452584 1:16506759-16506781 CAGCTGCACTGAAGGGAAATCGG + Intergenic
903029362 1:20451894-20451916 CAGCAGGCCTGGAGTTGAATGGG + Intergenic
904306128 1:29591597-29591619 CAGAAGACCGGGAGGGCAAGTGG + Intergenic
904575076 1:31500202-31500224 CAGCAAACCAGGAGTGAAACTGG - Intergenic
904616955 1:31755141-31755163 CAGGAGACCTGGAGGGAACAGGG - Intronic
905061725 1:35145491-35145513 CAGCAGACATGGAGTTAAAAAGG - Intergenic
905696793 1:39980614-39980636 CAGCTGCCCTGGAGGGAAAAAGG - Intergenic
906638648 1:47427516-47427538 CAGCAGACCTTGAGGGGGCTGGG + Intergenic
912680748 1:111727355-111727377 TTGCAGACCTGGTGGGCAATTGG - Exonic
914450290 1:147785604-147785626 AACCAGACCTGGAGGTAAATGGG - Intergenic
915493525 1:156265458-156265480 CAGAAGCCCTGGAGGGACTTGGG + Intronic
915688050 1:157656167-157656189 CAGCAGAAAAGGAGAGAAATTGG + Intergenic
917439511 1:175054761-175054783 GAGTAGAGCTGGAGGGAGATGGG + Intergenic
918213691 1:182374569-182374591 CAGCAGAAGGGGAGGGGAATGGG - Intergenic
918316275 1:183325119-183325141 CAGCAGATCAGGATGGATATTGG - Intronic
918860943 1:189825792-189825814 CAGCAGACATGGGGAGAACTCGG - Intergenic
919857854 1:201717925-201717947 CAACAGACCTGGAGGCAAGTGGG - Intronic
920256250 1:204656709-204656731 CAGCAGCCCTAGACGCAAATAGG - Intronic
921456436 1:215377586-215377608 CTGCAGAATTGGAGGGAACTTGG + Intergenic
922314702 1:224433483-224433505 GAGCGGACCTGAAAGGAAATAGG - Intronic
922453719 1:225757482-225757504 CATCAGACTTGGAGAGACATAGG - Intergenic
922938595 1:229440504-229440526 CAGCAGCACGGGAGGGAGATGGG + Intergenic
923373606 1:233337671-233337693 CAGCACACCTGCAGGGAACAAGG - Intronic
923411054 1:233709474-233709496 CAGGAAACATGGAGGAAAATTGG - Intergenic
923485779 1:234429714-234429736 CAAAAGACGTGGAGGCAAATTGG - Intronic
923657463 1:235930542-235930564 TAGCAGGCCTTGAAGGAAATTGG - Intergenic
924368342 1:243320460-243320482 CAGCAGCCTTGGAGGGCAAAAGG - Intronic
1063312992 10:4972919-4972941 CAACAGAGGTGGAGAGAAATAGG + Intronic
1063989022 10:11539298-11539320 CATCAGATCTGGAGTGAAAAGGG - Intronic
1064222181 10:13450826-13450848 GGGCAAACCTGGGGGGAAATGGG + Intronic
1064409130 10:15090104-15090126 CTGCAGACTTGGAGTGACATTGG - Intergenic
1064415013 10:15141538-15141560 CAGAAGTCCTGGAGGGTATTTGG - Exonic
1067344672 10:45428750-45428772 CAGCCTACCTGGATGGCAATGGG - Exonic
1067674091 10:48355032-48355054 CAGCAGACCTGCTGGAAAATAGG + Intronic
1067710622 10:48648675-48648697 CAGCTGTCCTGGGGGGAAAATGG + Intronic
1068062590 10:52087343-52087365 CAAAAGTCCTGTAGGGAAATGGG - Intronic
1071364915 10:84889720-84889742 CAGGAGAAATGGAGGAAAATAGG + Intergenic
1071730433 10:88243292-88243314 CAGCAGAGCTTCAGGGAAAATGG - Intergenic
1072250349 10:93577414-93577436 TAGCAGACCTGGATGGAGGTTGG - Intronic
1072409814 10:95191320-95191342 CAGCAAACCTAAAGGGAAACTGG + Intergenic
1073325710 10:102643244-102643266 GAGCAGAGGTGGAGAGAAATCGG + Intergenic
1073604951 10:104884858-104884880 AAGCACCCCTGGAGGGACATAGG - Intronic
1076445015 10:130508529-130508551 CAGCAGACCTGGAAGAGAACTGG + Intergenic
1077485538 11:2836844-2836866 CAGGGGCCCTAGAGGGAAATGGG + Intronic
1077571315 11:3340549-3340571 CTGAAGACCTGCAGGGGAATTGG + Intronic
1078449975 11:11433558-11433580 CAGCAGAGCTAAGGGGAAATGGG - Intronic
1078519323 11:12050814-12050836 CTGCAGAGCTGGAGGGAACTGGG + Intergenic
1078641925 11:13104796-13104818 GAGCAGACCAGGAGTGAAGTAGG + Intergenic
1079237692 11:18701558-18701580 CAGCAGACCTGGGGGTAAGAGGG - Exonic
1079971972 11:27046087-27046109 CATCAGACATGCAGGGAAAATGG - Intronic
1080826329 11:35852196-35852218 CAGCAGAGAAGGAGTGAAATGGG - Intergenic
1081840596 11:46198593-46198615 CAGCAGCCTTGGAGGGTAGTGGG + Intergenic
1083418038 11:62538003-62538025 CAGCAGACCTGGGGTGGAGTAGG - Intronic
1083972173 11:66085433-66085455 GAGCAGAACGAGAGGGAAATAGG - Intronic
1084357530 11:68650112-68650134 CAGCAGAGCAGGCGGGAAAGGGG - Intergenic
1085430575 11:76444816-76444838 CAGCAAACCTGGAGCGAAAGAGG + Intergenic
1087583982 11:100094700-100094722 AAGCAGACCAGGAGGAAAAAAGG + Intronic
1087875038 11:103344928-103344950 CAGCAGAACGGGAGGGAGACTGG - Intronic
1088189407 11:107211268-107211290 CACTAGACCTAGAGGGGAATGGG - Intergenic
1088526866 11:110765368-110765390 AAACAGAACTGAAGGGAAATAGG - Intergenic
1090958736 11:131537081-131537103 CTGCAGACCTTGAGGGAGCTGGG + Intronic
1091457729 12:620233-620255 CAAGAGACCTGGATGGAAATGGG + Intronic
1092520814 12:9270779-9270801 CAGCAGAGAAAGAGGGAAATAGG - Intergenic
1094490994 12:30960514-30960536 CAGCAGACCTGGAGGAAAGCAGG - Intronic
1096077266 12:48813681-48813703 AAGAAGACCTGGAGGGAGAGAGG - Intergenic
1096485135 12:51975250-51975272 CAGCAGAGCTGCAGGAAATTGGG - Exonic
1096568871 12:52507135-52507157 CAGCATAGCTGGAGGGAGCTGGG + Intergenic
1100587870 12:95996148-95996170 CAGCAGGTCTGGATGGAAAGTGG - Exonic
1101305377 12:103522538-103522560 GTGCAAACCTGGAAGGAAATGGG + Intergenic
1102016008 12:109648486-109648508 CAGCAGACAGGGATGGAGATTGG + Intergenic
1102644095 12:114392769-114392791 CAGCAGCCATTGAGGGAAACAGG + Intronic
1102688571 12:114742811-114742833 CAGCAGAGATAGAGTGAAATGGG + Intergenic
1104918808 12:132279911-132279933 CAGGAGACCTGGAGGACACTGGG - Intronic
1108003736 13:45927366-45927388 CTGCAGACCTTGGGGGAAGTTGG + Intergenic
1108584003 13:51852127-51852149 TAGCAGAGTTGGAAGGAAATAGG - Intergenic
1113664863 13:112134462-112134484 GAGGAGCCCAGGAGGGAAATGGG + Intergenic
1115067021 14:29275740-29275762 CAGCAGAAGTGGAGGGAAAAAGG - Intergenic
1118749446 14:68795502-68795524 CCGCAGCCTTGGAGGGAAAGCGG - Intronic
1119090151 14:71773611-71773633 CAGCAGGCCTGGAAGGAACCTGG + Intergenic
1120062233 14:79997482-79997504 AACCAGTCCTGGATGGAAATTGG + Intergenic
1120098877 14:80421527-80421549 CAACACAACCGGAGGGAAATAGG - Intergenic
1123673201 15:22681367-22681389 CTGCAGGCCTGGAGGTGAATTGG - Intergenic
1124325256 15:28754660-28754682 CTGCAGGCCTGGAGGTGAATTGG - Intergenic
1125682270 15:41539002-41539024 TAGGAGAGCTGGAGGGAAATGGG + Intronic
1126637277 15:50791773-50791795 CAGTAGACTTCAAGGGAAATGGG + Intergenic
1126740506 15:51772181-51772203 AAGGAGACCTGGAGAGAACTTGG + Intronic
1127885432 15:63195499-63195521 GAGAAAAGCTGGAGGGAAATAGG + Intronic
1128260722 15:66231184-66231206 CAACAGACCTGCAGGTAAAGAGG + Intronic
1131296644 15:91155173-91155195 CAGGAGCCCTGGAGCAAAATGGG + Intronic
1132851789 16:2028107-2028129 CAGGGGACCTGGAGGAAAAGGGG - Intronic
1133590417 16:7237284-7237306 CAGCAGACAGGGAGGGAGAGAGG - Intronic
1133743833 16:8672802-8672824 CAGCCTTTCTGGAGGGAAATTGG - Intergenic
1135109591 16:19680449-19680471 CAGCAGACCTGGCGGTGTATTGG + Intronic
1135504885 16:23027694-23027716 CAGAAGTCCAGGAGGGAGATGGG - Intergenic
1136927077 16:34384332-34384354 CAGCAGTCATGGAAGGAAATGGG - Intergenic
1136977497 16:35027475-35027497 CAGCAGTCATGGAAGGAAATGGG + Intergenic
1138493538 16:57392827-57392849 CAGCAGACAAGGAAGTAAATAGG + Intergenic
1140468127 16:75198295-75198317 CTGCAGTCCTGGAGGGAATCTGG + Intergenic
1141179960 16:81745781-81745803 CAGCAGATCTGGAGGGGCATGGG + Intronic
1141272322 16:82552667-82552689 CAGGAAACCTGGAGAGAAAAAGG + Intergenic
1142253506 16:89003070-89003092 CAGAAGACCTGGGGGGACAGAGG + Intergenic
1143394722 17:6584049-6584071 CAGGTGACCTGGATGTAAATAGG - Intronic
1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG + Exonic
1144657386 17:17045395-17045417 CATCAGACCTGGAAGGGACTTGG + Intronic
1144685624 17:17224136-17224158 GGGCAGACCTGGAGGGACACCGG + Exonic
1145246423 17:21272817-21272839 CAGCAGCCCCTGAGGGAGATTGG + Intergenic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1145378942 17:22376587-22376609 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145379899 17:22381327-22381349 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145380379 17:22383702-22383724 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145380858 17:22386049-22386071 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145381337 17:22388424-22388446 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145382545 17:22394563-22394585 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145382825 17:22395926-22395948 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145383398 17:22398749-22398771 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145383912 17:22401217-22401239 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145384350 17:22403419-22403441 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145384669 17:22404881-22404903 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145385450 17:22408954-22408976 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1147244673 17:39112035-39112057 CAGCAGAGATGGGTGGAAATAGG - Intronic
1148063849 17:44854530-44854552 CAGCAGAACTGATGGGAACTGGG - Intronic
1148864275 17:50620481-50620503 CAGAAGACCTGGAATTAAATGGG - Intronic
1149407805 17:56372406-56372428 CAGCAGGGCTGGAGAGCAATGGG + Intronic
1150303356 17:64064176-64064198 CAGGAGCCCTGGAGGGAGAGCGG + Intronic
1151404048 17:73875398-73875420 CAGCAGACTTGGGGGCAAACAGG + Intergenic
1151466503 17:74289163-74289185 CAGCAGGGCTGGAGGGCAACAGG - Intronic
1151759532 17:76092794-76092816 CAGCATCCCTGGAGGCAATTGGG - Intronic
1152098431 17:78286686-78286708 CAGCAGCCCTGGAGAGAAGGAGG + Intergenic
1152728062 17:81957401-81957423 CAGGAGACCAGGAGACAAATGGG - Intronic
1153673250 18:7432608-7432630 CAGCAAACTTGGATGGAAAGGGG - Intergenic
1153906343 18:9665086-9665108 CAGCAGAGCTGGAGGAGCATGGG + Intergenic
1156817683 18:41330280-41330302 TTGTAGACCTGGAGGGAATTTGG - Intergenic
1157564443 18:48670447-48670469 CAGCCAACCTGGAGGGAGGTGGG - Intronic
1158129535 18:54137645-54137667 CAGCAGATCTGGCCGGAAAAGGG - Intergenic
1158661550 18:59393051-59393073 GAGAAGAGATGGAGGGAAATGGG - Intergenic
1159633431 18:70777073-70777095 AAGTAGAGTTGGAGGGAAATTGG + Intergenic
1159751176 18:72304055-72304077 CAGCAGACCAAGAGGGAATGAGG + Intergenic
1161324518 19:3657017-3657039 CAGCATCTCAGGAGGGAAATAGG - Intronic
1161770947 19:6230417-6230439 CAGCAGAGCTGGAGGGGACCTGG - Intronic
1161878186 19:6928128-6928150 CAGCAGCTGTGGAGAGAAATAGG - Exonic
1162441672 19:10696120-10696142 CAGCCAACGTGGAGGGAAGTGGG - Intergenic
1163096411 19:15060777-15060799 CAGAAGACGTGAAGAGAAATGGG + Intergenic
1163351720 19:16780565-16780587 GAGCAGTCCAGTAGGGAAATAGG + Intronic
1165137857 19:33681655-33681677 CACCAGAGCTGCAGGGAACTTGG + Intronic
1167874722 19:52402256-52402278 CAGCAGACATGGATGGAGACGGG + Intronic
1167926763 19:52827484-52827506 CACCAGACATGGATGGAGATGGG - Intronic
1167932022 19:52873740-52873762 CACCAGGCATGGATGGAAATGGG - Intronic
1167942055 19:52955776-52955798 CACCAGACATGGATGGAGATGGG - Intronic
1167944948 19:52980640-52980662 CACCAGACATGGATGGAGATGGG - Intergenic
927370505 2:22349300-22349322 CAGTAGATCTGCAGGGAGATGGG - Intergenic
927486548 2:23492040-23492062 CAGAGGAACTGGAGGGAAAAAGG - Intronic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
928613117 2:33010096-33010118 CAGCAGCCATGGGGGGACATGGG + Intronic
929453266 2:42050011-42050033 CCCCAGCCCTGGAGGGAGATGGG + Intronic
929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG + Intergenic
931649891 2:64457901-64457923 CAGCAAAACTGAAGTGAAATAGG + Intronic
933396094 2:81733213-81733235 GACCAGAGCTGGAGAGAAATTGG + Intergenic
933704796 2:85281705-85281727 CGGGAGACCTGGTGGGAAGTGGG - Intronic
933731767 2:85461717-85461739 AAGCAGAATTGGAGGGAAACTGG + Intergenic
937013257 2:118580767-118580789 CAGAAGAGCTGGAAGGAACTAGG - Intergenic
938570233 2:132555987-132556009 CAGCAGATCTAGGGTGAAATGGG + Intronic
938648596 2:133356438-133356460 CAGCAGAGCTGTAGGGAAAGTGG - Intronic
938915522 2:135935145-135935167 CAGCAGAGCTGGACTGAATTTGG - Intronic
939209864 2:139160458-139160480 CAGCAGACATGGAAGGAACAGGG + Intergenic
939408663 2:141795411-141795433 CAGCAGCCCTTGAGGGAAGATGG + Intronic
940211070 2:151257187-151257209 TAGCAGACCTGAAAGGAATTTGG + Intronic
941617730 2:167740347-167740369 CAACATTCCTGGAGAGAAATAGG - Intergenic
942293052 2:174490678-174490700 CAGCGGGACTTGAGGGAAATCGG - Intergenic
945328385 2:208510631-208510653 CAGCAGAGCTCTAGAGAAATAGG - Intronic
945707234 2:213250269-213250291 CAGCAGATCTCGAGGTGAATGGG - Intergenic
946128455 2:217585456-217585478 CACCAGACCTGGAGGGAGTTGGG + Intronic
946308041 2:218867184-218867206 AAACAGTGCTGGAGGGAAATGGG - Intronic
946772741 2:223106028-223106050 CAGCAGATTTGGAGGGAAAGGGG - Intronic
948207493 2:236169932-236169954 CAGCAGACCTGGAGGAAAGAGGG + Intergenic
948408973 2:237744318-237744340 CACCAGACTTGGATGGAAAAAGG - Intronic
1169032164 20:2417949-2417971 CAGAACACCTGGAGCCAAATGGG - Intronic
1169276582 20:4237148-4237170 CAGAGGACCAGGAGGGAGATGGG + Intronic
1169494190 20:6098121-6098143 CAGCAGCCCTGGAAGTAAAATGG - Intronic
1169880531 20:10341825-10341847 CAGATGACCTGGAGGCAGATAGG + Intergenic
1172695360 20:36818845-36818867 CAGCAGACCTGTAGGAAAATAGG + Intronic
1174093704 20:48070360-48070382 CAGCAAGCCTGGATGGAAAATGG - Intergenic
1177338200 21:19761038-19761060 CAGGAGACCTAGATGGAATTTGG - Intergenic
1178179035 21:30138453-30138475 CAACAGACCTTCAGGAAAATGGG + Intergenic
1178589908 21:33900910-33900932 CATCAGACTTGGAGAGAACTAGG - Intronic
1179725453 21:43339133-43339155 ATCCAGACCTGGAAGGAAATGGG - Intergenic
1181417391 22:22770464-22770486 CCTGAGACCTGGAGGGAAAGAGG + Intronic
1182353952 22:29713806-29713828 CAGCAGATCTACAGGGAACTGGG - Intergenic
1182396880 22:30042543-30042565 GAGCAGATTTGGAGGGAAAAAGG + Intergenic
1182991535 22:34772287-34772309 CAGCAAACCGGGAGGAGAATAGG - Intergenic
1182991949 22:34776604-34776626 AAGGTGATCTGGAGGGAAATTGG + Intergenic
1184970097 22:48013343-48013365 CAGCAGACTTGGAAGGACAGTGG - Intergenic
1184974433 22:48051078-48051100 CAGCATGACTGGAGAGAAATGGG + Intergenic
1185122519 22:48980897-48980919 CAGCAGATCTGGAGGAAATATGG - Intergenic
949824658 3:8152941-8152963 CAGCAGACCCCCAGGGAACTGGG - Intergenic
949845503 3:8366356-8366378 CAGCATTCCTGGAGGGCAAGAGG - Intergenic
951712616 3:25600458-25600480 CTGTAGACCTACAGGGAAATGGG - Intronic
952003254 3:28810294-28810316 GAGCAGGGCTGGAGGGAACTGGG + Intergenic
952011034 3:28901689-28901711 TAGCTGACCTTGAGGGAAAATGG - Intergenic
952368025 3:32692070-32692092 CACCATGCCTGGCGGGAAATTGG - Intronic
952974712 3:38683821-38683843 CAGAAGGCCTGGAGTCAAATTGG + Intergenic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
954920573 3:54187482-54187504 CTGCAGGGCTGGAGGGTAATGGG + Intronic
956590383 3:70908333-70908355 CAGTTGACCTGGATGGAAGTGGG + Intergenic
958489796 3:94757791-94757813 CAGCAGGCCTGGAGAGAAGGTGG + Intergenic
959936013 3:112029515-112029537 CAACAGATCTGGTGGTAAATGGG - Intergenic
960569731 3:119173712-119173734 TAGCAGACTGGGAGGGAAAGGGG + Intronic
961307382 3:125968332-125968354 CAGAAGACCTGGAGACAAGTTGG + Intergenic
961566130 3:127764323-127764345 CTGCAGACCTGGAGTGGAAGGGG + Intronic
961807660 3:129500915-129500937 CAGTAGAGCAGGAGGGAACTTGG + Intronic
966951039 3:184818070-184818092 GAGCAGACATGAAGGGAAAGTGG + Intronic
967954279 3:194865619-194865641 TAGCAGACCTGAAGTCAAATGGG - Intergenic
968148678 3:196320396-196320418 CAGCAGCCCTGGAGAGGAAAGGG + Intronic
969211356 4:5689939-5689961 CAGCAGAGCTGGAGAGAAGCTGG - Intronic
970158670 4:13167345-13167367 TAGCAGACTTGGGGTGAAATGGG - Intergenic
971147074 4:23989458-23989480 CAGCAATCCTGCAGGAAAATTGG + Intergenic
972839719 4:42916236-42916258 CAGCAGACCCAGAGAGCAATTGG + Intronic
975642686 4:76516081-76516103 CAGTAGACCGAGAGGGAAAGTGG + Intronic
975769597 4:77707101-77707123 TGGGAGACCTGGAGGGAAACTGG + Intergenic
978094661 4:104761404-104761426 CAGCAGGAATGAAGGGAAATGGG - Intergenic
978645394 4:110925079-110925101 CAGCAGAGATGGAGAGAAACTGG - Intergenic
982841521 4:160193902-160193924 CAGCAAAACTGGAGGCAAACTGG - Intergenic
984739440 4:183146158-183146180 CCTCAGACCTGGAGGGAGAAAGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985135935 4:186786218-186786240 CAAAAGAGCTGGAGGGAAACAGG - Intergenic
985552505 5:540787-540809 CAGCAGGCCAGGAGGGAGACGGG - Intergenic
985772218 5:1819577-1819599 CAGCTGCCTTTGAGGGAAATGGG + Intergenic
986144713 5:5066461-5066483 CAGCAGGGCTGGGAGGAAATTGG + Intergenic
987396391 5:17428606-17428628 CAGGAGACCTGGCGGGGAAGGGG + Intergenic
992982338 5:82188694-82188716 CAGAGGACCTGGAGGGGAAATGG + Intronic
993467961 5:88270597-88270619 CAGAATACCTGGAGGGAAGGTGG + Intergenic
995077124 5:107999017-107999039 CAGCAGACCTGGAGGGAAATGGG - Intronic
997580754 5:135015338-135015360 CTGCAGAGCTAGAGGGAAAGGGG + Intergenic
1000003984 5:157166243-157166265 CAGAAGTCCTGTAGGGAGATGGG - Exonic
1000349745 5:160343971-160343993 CAGCAGAGCTGAAGGGCAAGTGG - Intronic
1001806490 5:174591202-174591224 TAGGAGACCTCAAGGGAAATGGG - Intergenic
1002081785 5:176741701-176741723 CAGAAGACTGGGAGGGAAGTGGG + Intergenic
1002095449 5:176828315-176828337 CTGCAGACCTGGGGGGCAGTGGG + Intronic
1002311624 5:178318566-178318588 CAGCAGACCTGGACAGGAAGGGG + Intronic
1003314661 6:5001604-5001626 CAGCAGATATGGGTGGAAATGGG + Intronic
1003488405 6:6599607-6599629 CACCAGGCTTGTAGGGAAATAGG - Intronic
1003509230 6:6765550-6765572 CAGGAGATCTGGAGGGAACAAGG + Intergenic
1003873872 6:10420658-10420680 CAGCAGCCCGGGAGGGTAACTGG - Intergenic
1005264882 6:24101233-24101255 CAACAGGGCTGGAGGAAAATGGG + Intergenic
1006327136 6:33362876-33362898 CAGCAGCCATGCAGGGTAATGGG - Intergenic
1007104889 6:39276900-39276922 GAGCTGTCCTGGCGGGAAATGGG - Intergenic
1007318783 6:41011302-41011324 CAGAAGATCTGAGGGGAAATGGG + Intergenic
1007394555 6:41570154-41570176 CAGCAGTCCTGAAGAGAAATGGG - Intronic
1007408533 6:41648557-41648579 GACCAGGCCTGGAGGGAGATGGG + Intronic
1007820312 6:44555953-44555975 CCACACAGCTGGAGGGAAATTGG + Intergenic
1008606533 6:53145473-53145495 GCGGAGACCTGGAAGGAAATTGG - Intronic
1010360205 6:74984728-74984750 CAAAAGAATTGGAGGGAAATTGG + Intergenic
1012143331 6:95650704-95650726 GAAGAGACCTGGAGGGAATTTGG + Intergenic
1012464734 6:99504536-99504558 CAGAGGATCTGGAGAGAAATGGG + Intronic
1017740032 6:157398282-157398304 CTGCAGTCCTGGAGGGAACCTGG + Intronic
1018927622 6:168217438-168217460 CAGGAGACCTGGAAGGGAAGCGG - Intergenic
1019351741 7:557183-557205 CAGCAGCCAAGGAGGGAAAGAGG + Intronic
1019853687 7:3583937-3583959 CAGCAGACCAGGAAGGAATAAGG + Intronic
1022872777 7:34496940-34496962 CACCAGACTTGGAGGTAAATTGG - Intergenic
1023122764 7:36926023-36926045 AAGGGGACTTGGAGGGAAATGGG - Intronic
1023890175 7:44386314-44386336 GAGCAGTCTTGGAGAGAAATTGG - Intronic
1024272618 7:47654083-47654105 CAGCAGAACTGAAGGGCAAGAGG - Intergenic
1024775693 7:52783081-52783103 CATCACACCTGGCTGGAAATGGG - Intergenic
1026077488 7:67185587-67185609 CAGGAAACCAGGAGGGAAAAGGG + Intronic
1026699382 7:72626564-72626586 CAGGAAACCAGGAGGGAAAAGGG - Intronic
1028749621 7:94368091-94368113 CAGCAGAGCTGGAGGCCATTAGG - Intergenic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029962307 7:104700895-104700917 CAGCAGGCCTGGAGATAAATTGG - Intronic
1030907888 7:115209030-115209052 CAGCAGAGGTGGCAGGAAATAGG + Intergenic
1031064385 7:117089190-117089212 AAGCAGACATGGAGACAAATTGG - Intronic
1031691703 7:124796499-124796521 CAGCAGACCCAGAGAAAAATTGG - Intergenic
1032653457 7:133903411-133903433 CAGCAGAGATGGAGGGAACTGGG + Intronic
1033757856 7:144410180-144410202 CACCAGACCTGGAGGGTACCTGG - Exonic
1035477910 7:159156743-159156765 AAACAGAACTGAAGGGAAATTGG - Intergenic
1037749945 8:21674980-21675002 CTGCCGACCTGAAGGGAAAGAGG + Intergenic
1039505904 8:38052132-38052154 CAGCAGCCCTGAAGGGACCTTGG + Intronic
1040984404 8:53278276-53278298 CAGCAGGCCTGCAGAGAAGTGGG + Intergenic
1041571484 8:59342271-59342293 CAGCCGACCTTGATGGAAAATGG - Intergenic
1041627249 8:60044654-60044676 GAGCAGACCATGAGGGCAATAGG - Intergenic
1042577680 8:70238912-70238934 TTGCAGATATGGAGGGAAATGGG - Intronic
1042836953 8:73087659-73087681 CATCATATCTGGAGGGAAAGAGG - Intronic
1043284369 8:78511400-78511422 CAGGAGACCTGGCAGGAAATGGG + Intergenic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047804316 8:128343507-128343529 CAGGAAATCTGGAGAGAAATAGG + Intergenic
1048217020 8:132505700-132505722 GAGAAGACTTGGGGGGAAATAGG - Intergenic
1048475121 8:134736022-134736044 CACCTGTCCTGGAGGGAAACTGG + Intergenic
1048998905 8:139812016-139812038 CAGCAGACCTGGAGGACATCAGG + Intronic
1050720245 9:8580910-8580932 CAGCAAACCTATTGGGAAATAGG - Intronic
1052913716 9:33907493-33907515 GAACAGACCTAGAGGGAATTTGG - Intronic
1056058832 9:82861115-82861137 CAGCAAACCTGAAAGGAAAAAGG + Intergenic
1057302294 9:93893958-93893980 CAGCAGAGCGGGAGGGAGGTGGG - Intergenic
1060525271 9:124316794-124316816 CCTCAGACGTGCAGGGAAATGGG + Intronic
1061196380 9:129109359-129109381 CAGGAGTCCTGGAGAGAAACAGG - Intronic
1062002231 9:134222123-134222145 CAGCATAGCTGGAGGACAATGGG + Intergenic
1185783685 X:2871078-2871100 GGGCTGAGCTGGAGGGAAATTGG + Intronic
1187108354 X:16268975-16268997 CAGTAGACCTGGAACTAAATGGG - Intergenic
1187581939 X:20616505-20616527 CAACTGTCCTGGAGGGAAACTGG + Intergenic
1187931465 X:24297231-24297253 CAGCAGATATGTAGGGAATTAGG - Intergenic
1189033304 X:37471197-37471219 CTCAAGACCTGGAGGGAAACTGG + Intronic
1189232632 X:39464387-39464409 CAGCAGACCCAGAGAGAAACTGG + Intergenic
1192051129 X:67724886-67724908 AAGCAGACCTGGATCCAAATGGG - Exonic
1192146947 X:68688580-68688602 CTGCAGCCCTGGAGGGACACTGG + Intronic
1192222055 X:69203949-69203971 GAGCAGACCTGGAGGCAGAGAGG + Intergenic
1193977285 X:88137268-88137290 TACCAGGCCTGGATGGAAATAGG + Intergenic
1195175384 X:102310426-102310448 CAAAAGACCTTGAAGGAAATGGG + Intronic
1195183480 X:102376667-102376689 CAAAAGACCTTGAAGGAAATGGG - Intronic
1195202805 X:102566080-102566102 GAACAGGCCTGGAGGGAAAAAGG - Intergenic
1195989486 X:110668412-110668434 CAGCTGCCCTGGAGGGATTTAGG + Intergenic
1196194398 X:112824714-112824736 CAGGAGTCCTGGAGGCACATTGG - Intronic
1196960328 X:120993638-120993660 AAGGAGACCTAGTGGGAAATAGG - Intergenic
1199701587 X:150381513-150381535 GAGCAGATCAGGAGGGAAGTGGG - Intronic