ID: 995083220

View in Genome Browser
Species Human (GRCh38)
Location 5:108078302-108078324
Sequence AGGTTGTTAGAGATGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995083220_995083226 10 Left 995083220 5:108078302-108078324 CCTTTGTCCATCTCTAACAACCT 0: 1
1: 0
2: 0
3: 23
4: 189
Right 995083226 5:108078335-108078357 TCTCTCCAAAGGTATCAGCTTGG No data
995083220_995083223 -1 Left 995083220 5:108078302-108078324 CCTTTGTCCATCTCTAACAACCT 0: 1
1: 0
2: 0
3: 23
4: 189
Right 995083223 5:108078324-108078346 TCTAACCCAAATCTCTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995083220 Original CRISPR AGGTTGTTAGAGATGGACAA AGG (reversed) Intronic
901328275 1:8383117-8383139 AGAATGTTAGAGATGGTGAATGG + Intronic
905768809 1:40624425-40624447 AAGTTCTTGGAAATGGACAAAGG - Exonic
907825912 1:58016741-58016763 AGCTTATTACAGATGGAGAATGG - Intronic
907826767 1:58025162-58025184 ATGTTGCTAGAGATGTATAAGGG - Intronic
909903150 1:81162762-81162784 AGGTTGTTATATAATGACAAAGG + Intergenic
911222526 1:95263984-95264006 GGGTTGTTAAAGCTGGACACAGG - Intergenic
911232668 1:95377498-95377520 GTGATGTTAGAGATGGACCATGG + Intergenic
911637654 1:100253116-100253138 AGCTTGTTAGAAATGCAGAATGG - Intergenic
915732883 1:158066716-158066738 AGGCTGCAAGAGATGGAGAAAGG - Intronic
918849030 1:189659584-189659606 AGGTTGTAAGAAATCGACAGTGG - Intergenic
923195861 1:231666738-231666760 AGGTTCTTAGTGAAGGAAAAAGG + Intronic
923211081 1:231804966-231804988 AGGATGTTAGAAATGAAAAAAGG + Intronic
1066034110 10:31463589-31463611 AGGATGGTAGAGATGGAAAATGG - Intronic
1066613905 10:37277534-37277556 AGGTTGATAGAGAGATACAAAGG + Intronic
1067178156 10:43964648-43964670 ATGTTGTTGGAGATGGACAGAGG - Intergenic
1068791663 10:61036716-61036738 AGCTTGGTATAGAGGGACAATGG + Intergenic
1068965970 10:62912401-62912423 AGATCATTAGAAATGGACAATGG + Intronic
1070163582 10:73881156-73881178 AGGGTGGTAGAGATGGCCACAGG + Intergenic
1070575031 10:77671159-77671181 AGGTAGAGAGAGATGGACAGAGG + Intergenic
1071306295 10:84302013-84302035 ATGCTGTTTGTGATGGACAATGG - Intergenic
1071569795 10:86690642-86690664 AGGGTATAAGACATGGACAATGG + Intronic
1072166110 10:92814690-92814712 AGGGTGGTAGTGATGGACATGGG - Intergenic
1072780569 10:98248580-98248602 AGTTTCTTAGGGATGGACTATGG - Exonic
1073546582 10:104354321-104354343 AGGGTGTGACAGGTGGACAAGGG - Intronic
1074443832 10:113501682-113501704 AAGTTGTCAGAGAAGGAAAAGGG + Intergenic
1080275802 11:30502296-30502318 AGGTTACTATAGATGGATAATGG - Intronic
1080422572 11:32124545-32124567 AGATTGATAGAGGTGAACAATGG + Intergenic
1081258858 11:40933115-40933137 AGGTTGATAGAGAAAGATAAAGG + Intronic
1081506961 11:43727830-43727852 AGGTTGGGAGAGATGAACTATGG + Intronic
1082939070 11:58684862-58684884 AAATTGTTAGAGCTGAACAAGGG + Intronic
1084757165 11:71246880-71246902 AGATTTTTAGAAATGGAAAAGGG - Intronic
1084911472 11:72393000-72393022 AGTCTGTTTGAGATAGACAAGGG + Intronic
1086222920 11:84471383-84471405 GGGTTGTTGGAGAAGGACAGAGG - Intronic
1089226479 11:116927181-116927203 AGGATGTCAGATAGGGACAAAGG - Intronic
1090339105 11:125999783-125999805 AGGATGTTAGAGAAGGAGAAGGG - Intronic
1091909641 12:4219208-4219230 AAGTTGTTTGGGATGGACAGAGG - Intergenic
1092514197 12:9191318-9191340 AGGTAGTTAGATATGGAGAATGG - Intronic
1093181349 12:15970984-15971006 AGGTTGTAAGATTTGGAAAAAGG + Intronic
1095142315 12:38680715-38680737 ATGTTGTTAGAGATAGATCATGG + Intronic
1098881668 12:75923808-75923830 AGGTTGTTATAAATGGAAAATGG - Intergenic
1099606246 12:84805357-84805379 TGGTTGATAGAGACGAACAATGG + Intergenic
1100800914 12:98229318-98229340 AGGAAGTGAGAGATGGTCAAAGG + Intergenic
1104082113 12:125438253-125438275 AGGTTTTTGGAGATTGGCAACGG + Intronic
1104372410 12:128235454-128235476 AGGTAGGGAGAGAAGGACAACGG + Intergenic
1106384203 13:29268269-29268291 ATGTTTTTTGAGATGGACAGCGG + Intronic
1107670121 13:42736839-42736861 ATGTTGTTTGAGCTGAACAACGG + Intergenic
1109683383 13:65783251-65783273 TGGTTGTTAGAGATGGGAATAGG + Intergenic
1110366446 13:74691604-74691626 ATGTGGTGAGAGAAGGACAAGGG + Intergenic
1110367306 13:74701413-74701435 AGATTGATAGAGATAGACAGAGG + Intergenic
1110644014 13:77860194-77860216 AGGCTGATAGAGAAGGAAAAAGG - Intergenic
1111091975 13:83459052-83459074 AGATTGTCATAGATGGAAAAGGG - Intergenic
1112623446 13:101076759-101076781 AGGTTCTTGGAGAAGAACAAAGG + Intronic
1114246230 14:20916885-20916907 AGGTAGTTAGAAATGTACACAGG + Intergenic
1114512236 14:23272068-23272090 TATTTGTTAAAGATGGACAATGG + Intronic
1115051223 14:29065922-29065944 AGATTGTTATAGGTGGACCATGG - Intergenic
1115594752 14:34898648-34898670 AGGTTGTTAGAGAAGGAGCACGG + Intergenic
1117223712 14:53633612-53633634 AGGTTGTTAGTCATTTACAAGGG - Intergenic
1118250046 14:64150838-64150860 AGGGTGGCAGAGATGGACAGAGG + Intronic
1118336946 14:64861562-64861584 AGGTAGCTAGGGATGGAGAAAGG - Intronic
1119009247 14:70966657-70966679 AGATTGTTAAAGAAGGAGAAAGG + Intronic
1120639508 14:86993290-86993312 AGCTTGTTAGAGAATGAAAATGG + Intergenic
1122080257 14:99262225-99262247 CAGTTGTTAGAGATGGGCCAGGG - Intronic
1125416614 15:39460503-39460525 TGCTTTTTAGAGATGGACAAAGG - Intergenic
1126606677 15:50484963-50484985 TGGTTGTCAGAGCTGGAGAAAGG + Intronic
1130234839 15:82124510-82124532 AGGCTGTAAGAGGGGGACAAGGG - Intergenic
1130688657 15:86061335-86061357 AGGTTGCTAGAGATAGGCAAAGG - Intergenic
1132316236 15:100892430-100892452 AGGTTGTTAAAGATGGAAGTTGG - Intronic
1133201799 16:4208340-4208362 ACTTCGTTAGTGATGGACAACGG - Intronic
1133698554 16:8287934-8287956 AGGTTGTTAAATAGCGACAAGGG - Intergenic
1138321525 16:56117858-56117880 AAGTTGTGAGAGTTGGACATGGG + Intergenic
1142143241 16:88481862-88481884 AGGTTTTGAGAAATGGGCAAGGG - Intronic
1144441901 17:15290852-15290874 GGATTGTTAGAGATGGACGCTGG + Intergenic
1144617391 17:16788995-16789017 AGGGTGATTCAGATGGACAAAGG - Intronic
1144895311 17:18526687-18526709 AGGGTGATTCAGATGGACAAAGG + Exonic
1145136910 17:20417544-20417566 AGGGTGATTCAGATGGACAAAGG - Intergenic
1146949469 17:36895761-36895783 AGCTTGTTAGAGTTAGAAAATGG - Intergenic
1147049228 17:37778631-37778653 AGCTTGTTAGAAATGCAGAACGG + Intergenic
1149870122 17:60173416-60173438 AGGGTGATTCAGATGGACAAAGG - Intergenic
1150100746 17:62421474-62421496 AGGTTGTTAGCCAAGGACAAGGG - Intergenic
1150471242 17:65439160-65439182 AGGGTGGCAGAGAGGGACAATGG - Intergenic
1151124662 17:71831894-71831916 AGGTTCTTTGAGGTGGATAATGG + Intergenic
1153102019 18:1483040-1483062 AGGCTGCTAGAGTTGGGCAAAGG + Intergenic
1156151162 18:34244931-34244953 AAGTTCTTAGAGATGTACAAAGG - Intergenic
1156620222 18:38842829-38842851 AGGTTGTTGTAGAAGCACAATGG + Intergenic
1158929796 18:62312801-62312823 AGGTTGAGAGAGAAGGACTAAGG + Intergenic
1159194200 18:65090734-65090756 GGGATGTCAGAGATGAACAAAGG + Intergenic
1159204837 18:65236162-65236184 AGGTTGGTTGAGAAGAACAACGG + Intergenic
1159818526 18:73109484-73109506 AGGTTATTAGGGATAGAGAAGGG - Intergenic
1164149281 19:22535169-22535191 AGGTTGTTAGAGGAGGGAAAAGG - Intergenic
1165203946 19:34168060-34168082 AAATTGTTACAGATGGAAAAAGG - Intergenic
1166165016 19:40981315-40981337 AGGTGGTTTCAGATGGAGAAGGG - Intergenic
1166583768 19:43927188-43927210 AGGATGTTAGAGAGGAATAAGGG - Intronic
1167026828 19:46925817-46925839 AGGTTGTGAGAAATGAACACCGG + Intronic
930178038 2:48320136-48320158 AGGTTGGAAGGGTTGGACAAAGG - Intronic
931070269 2:58639477-58639499 AGGATGGTAGATATGGATAAAGG + Intergenic
932962790 2:76434661-76434683 ATATTGTGGGAGATGGACAAAGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936963237 2:118099019-118099041 AAGTTGCCAGAGATGGAAAATGG + Intronic
937378817 2:121357046-121357068 GGGTTTTTAGAGATGGATACCGG - Intronic
937832443 2:126438299-126438321 AGGCTGGGAGAGATGGTCAAAGG - Intergenic
938628335 2:133136707-133136729 AGGCCATTAGAGAAGGACAAAGG + Intronic
938684547 2:133724934-133724956 AGGTTGGAAGAGCAGGACAATGG + Intergenic
938948381 2:136235047-136235069 AGGTTGTGAGAGCAGGACAAAGG + Intergenic
939849599 2:147288666-147288688 AGGATGGTAGAGATGGACATGGG + Intergenic
942519615 2:176790053-176790075 AGGAAGATAGAGATGGAAAATGG - Intergenic
942522418 2:176818547-176818569 AGGTTATGAGAAAAGGACAAGGG + Intergenic
943786931 2:191887569-191887591 AGGGTGTAAGAGATGATCAAAGG - Intergenic
946715010 2:222544864-222544886 GGGGTGTTAGTTATGGACAAGGG + Intronic
947818824 2:233056957-233056979 AGGCTGGGAGAGAGGGACAATGG - Intergenic
1168730680 20:77107-77129 AGGTTGTTATATAATGACAAGGG + Intergenic
1168944895 20:1745080-1745102 AAGATGTTAGAGAAGGAAAATGG + Intergenic
1173903682 20:46610357-46610379 AGGATGTTAGGGAAGGCCAAGGG - Intronic
1174166081 20:48584460-48584482 AGGTTGTCTCAGATGAACAATGG + Intergenic
1175358186 20:58385662-58385684 AGGTTAATAGACATGGAGAAGGG + Intergenic
1177051117 21:16235245-16235267 AGGATGATGGAGATGGAGAAAGG - Intergenic
1178500050 21:33118251-33118273 ACCTTGTTGGAGATGGACAGGGG + Intergenic
1178592558 21:33923828-33923850 GTGTTGATAGAAATGGACAATGG + Intergenic
952866516 3:37859072-37859094 AGGAAATTAGAGATGGACTAAGG + Intergenic
953076477 3:39575472-39575494 AGGTTGTGATAGTTGGAAAATGG + Intergenic
953899692 3:46833053-46833075 AGGATGTTGGAGCTGGAGAAGGG + Exonic
956301665 3:67779244-67779266 AAGTTCTTAGAGATGAACAAAGG - Intergenic
956634035 3:71345520-71345542 AGGCAGTTAGAACTGGACAAGGG - Intronic
962057958 3:131892967-131892989 AGGTTGTTAATAATGGATAAAGG - Intronic
962456980 3:135573717-135573739 AGGATGCTAGAGATGCACAAAGG - Intergenic
963210695 3:142686503-142686525 AAGTTTGTAGAGATGGATAATGG - Intronic
963263808 3:143219210-143219232 AGGTTGTTAGATAGAGACAAAGG + Intergenic
964474564 3:157087041-157087063 AGCTTGTTAGGGATAGAAAAGGG + Intergenic
966014079 3:175119480-175119502 AGGTTATTTGAGAAAGACAAAGG + Intronic
967379649 3:188843457-188843479 AGGATGTCAGAGATGAAAAAGGG - Intronic
967405006 3:189105597-189105619 AGGTTGTTGGGGATAGAAAAGGG - Intronic
969880243 4:10167355-10167377 AGGTTGTCTGAAGTGGACAAGGG - Intergenic
971392743 4:26201286-26201308 AGGATGTTGGAGACGGAAAAAGG + Intronic
973977108 4:56273229-56273251 AAGTTGCTAGAGATGGCCAGGGG - Intronic
975168284 4:71202727-71202749 AGATTGTTAGAAATGAACCATGG + Intronic
976108941 4:81649670-81649692 ATGTTGTCAGAGAAGGATAATGG - Intronic
976483915 4:85577875-85577897 AAGTTGTTAGAAATTGATAATGG + Intronic
977470186 4:97433632-97433654 AGGTTGGGAGATATGGTCAAAGG + Intronic
977894674 4:102349761-102349783 AGAATGTCAGAGATGGGCAAGGG + Intronic
979532584 4:121784929-121784951 AGGCTGCTAGAAAAGGACAATGG + Intergenic
984013252 4:174397402-174397424 AAAATGTTAAAGATGGACAATGG - Intergenic
984652504 4:182285807-182285829 ATGTTTTCAGAGATGGACCAAGG + Intronic
985401448 4:189598327-189598349 ATGTGGTTAAAGATGGACAGGGG - Intergenic
989777013 5:45221293-45221315 AGGTAATTAGAGAATGACAAAGG + Intergenic
990016266 5:51065885-51065907 AAGTTCTTAGAGACCGACAAAGG + Intergenic
990104444 5:52239771-52239793 AGGTAGTTTGAGATGGATCATGG - Intergenic
990356683 5:54974615-54974637 AGGTTGTCTGGGAAGGACAAAGG - Intergenic
991128383 5:63092810-63092832 AAGTTGTTAGAGACCTACAAAGG + Intergenic
993080176 5:83286806-83286828 ATGTTGAGAGAGGTGGACAATGG + Intronic
995083220 5:108078302-108078324 AGGTTGTTAGAGATGGACAAAGG - Intronic
995553927 5:113308475-113308497 AGGTTTTTAGAGATGGGGATGGG - Intronic
998244804 5:140490171-140490193 ATGTGATTAGGGATGGACAAAGG + Intronic
999795531 5:154986046-154986068 AGGTTCTTAGAGATTCACATAGG + Intergenic
1000467688 5:161600355-161600377 TGGTTGTTAGAAATTGAAAAGGG + Intronic
1005061031 6:21777318-21777340 AGATGGCTAGAGATGGACTATGG - Intergenic
1005952659 6:30643055-30643077 AGGATGTTAGAAATGGCAAAGGG + Intronic
1008890307 6:56480806-56480828 AGGGTGTTAGATATGCACAATGG + Intronic
1009498135 6:64375751-64375773 GGTTTTTTAGAGAAGGACAAAGG + Intronic
1009537806 6:64912128-64912150 AGTTAGTTAGAGATGGGCATAGG - Intronic
1009757846 6:67963232-67963254 AGCTTATTAGAAATGCACAAGGG + Intergenic
1010275745 6:73966644-73966666 AGGTTGGTAAAGATGGACCAGGG + Intergenic
1010577667 6:77552600-77552622 AGGGTGTCAGAATTGGACAAGGG + Intergenic
1013561374 6:111308963-111308985 AGGGTGTGCGAGAGGGACAATGG + Intronic
1014756307 6:125305047-125305069 GGGTTCTTAAAGATGGAAAAGGG + Intergenic
1014901686 6:126973315-126973337 AGGTTTTAAGAAATGGAGAATGG + Intergenic
1015507427 6:134003645-134003667 AGGATGTTTGACTTGGACAAGGG - Intronic
1016928990 6:149383363-149383385 AGGTTGTTAGAGCTGTCCGAAGG - Intronic
1018667924 6:166156428-166156450 AGGGTTGTGGAGATGGACAAGGG + Intergenic
1019127844 6:169852741-169852763 ATTTTGGAAGAGATGGACAAGGG - Intergenic
1021406820 7:20277379-20277401 AATTGCTTAGAGATGGACAAGGG - Intergenic
1021663312 7:22944566-22944588 AGGTAGTGAAATATGGACAAAGG - Exonic
1023888449 7:44376693-44376715 AGGGTCTTAGAGATGGACACTGG - Intergenic
1023888552 7:44377062-44377084 AGGGACTTAGAGATGGACACAGG - Intergenic
1027945673 7:84742415-84742437 AGGTTGTACATGATGGACAAGGG - Intergenic
1030635178 7:111940010-111940032 AGGTGGGTAGAGAAGAACAATGG - Intronic
1032029892 7:128474323-128474345 AGGTTGTTAGCCAAGGACAAGGG - Intergenic
1032144020 7:129362385-129362407 AGGTTGTGAGATAGGGAGAAGGG + Intronic
1032357411 7:131223611-131223633 AGCATTTTAGAGATGGAGAATGG - Intronic
1033511529 7:142064537-142064559 AGGTTGTGACAGCTGGAGAAGGG - Intronic
1033514591 7:142093565-142093587 AGGTTGTGACAGCTGGAGAAGGG - Intronic
1033836249 7:145315538-145315560 AGCTTGTTAGAAATGCATAATGG - Intergenic
1034588625 7:152119192-152119214 AATTTGTTAGAAATGGCCAAGGG + Intronic
1034682484 7:152939740-152939762 ATGTAGTTAGAGATGGACCGGGG + Intergenic
1034880218 7:154757253-154757275 AGGATGTGAGGGATGGAGAAGGG - Intronic
1037291166 8:17350633-17350655 AGGTGGGTGGAGATGGACACAGG - Intronic
1038204607 8:25453975-25453997 ACGTTGTTAGAGTTGGAGAAAGG - Intronic
1038516370 8:28190881-28190903 TGGTTGTTATAAATGGAGAAAGG + Exonic
1039919371 8:41882506-41882528 AGGGTGTTGGAGATGGGCACTGG + Intronic
1041629944 8:60075973-60075995 AAGATGTTAGAAATGGACATTGG + Intergenic
1044327957 8:90881886-90881908 AAGTTGGTAGAGCTGGACAAAGG + Intronic
1046869825 8:119193469-119193491 TGGGTATTAGACATGGACAAGGG + Intronic
1053330424 9:37201191-37201213 AGCTTGTTAGTGATTGAAAAGGG + Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055075827 9:72214047-72214069 ATGGAGTTAGAGATGGAAAAAGG + Intronic
1058155383 9:101508933-101508955 AGGATGTTAGAAATGGAAACAGG + Intronic
1059700477 9:116771078-116771100 TGGTTGTTAGGCAAGGACAAAGG - Intronic
1060769469 9:126321351-126321373 AAATTATTAGACATGGACAAAGG + Intergenic
1060823278 9:126673509-126673531 AGGGAGGTGGAGATGGACAAGGG + Intronic
1062712606 9:137984874-137984896 AGGTAGTGAGAGAAGGACCAGGG + Intronic
1185998316 X:4978254-4978276 AATTTGTTACAGATGGGCAAAGG + Intergenic
1186517283 X:10175309-10175331 AGGTTGGAGGAGATGGAAAAAGG + Intronic
1188399343 X:29725602-29725624 AGGATGCCAGAGATGGACCATGG - Intronic
1188859079 X:35235077-35235099 AAGTTCTGAGAGATGGACAGAGG + Intergenic
1192666336 X:73091203-73091225 AGATTGTTATAGAAGGATAAAGG - Intergenic
1193614360 X:83669790-83669812 AAGTTCTTAGAGATGTACAAAGG + Intergenic
1194031522 X:88822454-88822476 AAGTTATTAGAGATGTACAAAGG - Intergenic
1197306853 X:124853159-124853181 AGCATGTTAGATATTGACAAGGG + Intronic
1199175384 X:144782266-144782288 AGTCTGTTATAGTTGGACAAAGG - Intergenic
1199819681 X:151432442-151432464 AGGTTGTTAAAGATGGGAATTGG - Intergenic
1200223036 X:154401378-154401400 AGGTTGCTAGAGATAGGAAATGG - Exonic